SAXSdb — 1z19

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Integrase

Enterobacteria phage lambda

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 6	5'-D(CPTPCPGPTPTPCPAPGPCPTPTPTPTPTPT)-3' × 2 5'-D(PTPTPTPAPTPAPCPTPAPAPGPTPTPGPGPCPAPTPTPA)-3' × 2 33-MER × 2 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	VINT_LAMBD
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain A； PDBConstruct 1–283； UniProt 74–356 Author chain B； PDBConstruct 1–283； UniProt 74–356

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1z19
Deposition date deposition_date	2005-03-03
Structure title title	Crystal structure of a lambda integrase(75-356) dimer bound to a COC' core site
Keywords keywords	PROTEIN-DNA COMPLEX, DNA BINDING PROTEIN-DNA COMPLEX; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1z19__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1z19__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1z19__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	36.69 Å
Rg (electron density)	35.90 Å
Total Rg	36.40 Å
Atom count	11292
Residues	1210
Excluded volume	193710 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1z19__assembly_1__model_1`	decameric （10）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	5'-D(CPTPCPGPTPTPCPAPGPCPTPTPTPTPTPT)-3'
Molecular weight formula_weight	4821.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C
Atom count atom_count	5677

CTCGTTCAGCTTTTTT

Entity 2 Entity 2 polymer

Description description	5'-D(PTPTPTPAPTPAPCPTPAPAPGPTPTPGPGPCPAPTPTPA)-3'
Molecular weight formula_weight	6138.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

TTTATACTAAGTTGGCATTA

Entity 3 Entity 3 polymer

Description description	33-MER
Molecular weight formula_weight	10203.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

TAATGCCAACTTAGTATAAAAAAGCTGAACGAG

Entity 4 Entity 4 polymer

Description description	Integrase
Molecular weight formula_weight	32289.8 kDa
Mutation mutation	E174K
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPLEDITTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSKVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQYRDDRGREWDKIEIK

Source Source

Source organism organism	Enterobacteria phage lambda
NCBI taxonomy ID ncbi_taxonomy_id	10710
Host organism host_organism	Escherichia coli

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	31

▼

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (2 domains)

Domain ID domain_id	d1z19a_
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1z19b_
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

CATH v4.4 (4 domains)

Domain ID domain_id	1z19A01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	1z19A02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1z19B01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	1z19B02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

▶

Unit-cell length a length_a	109.297 Å
Unit-cell length b length_b	121.481 Å
Unit-cell length c length_c	65.387 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	0.2180
R_work r_work	0.2180
R_free r_free	0.2620

Crystal structure of a lambda integrase(75-356) dimer bound to a COC' core site

1. Protein Identity and Related Structures Protein Identity & Related Structures

Integrase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1z19__assembly_1__model_1

1z19__assembly_1__model_1 | I(q)

1z19__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (2 domains)

CATH v4.4 (4 domains)

7. Citations (1)

Crystal structure of a lambda integrase(75-356) dimer bound to a COC' core site

1. Protein Identity and Related Structures Protein Identity & Related Structures

Integrase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1z19__assembly_1__model_1

1z19__assembly_1__model_1 | I(q)

1z19__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (2 domains)

CATH v4.4 (4 domains)

7. Citations (1)