2bte

Thermus thermophilus Leucyl-tRNA synthetase complexed with a tRNAleu transcript in the post-editing conformation and a post- transfer editing substrate analogue

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

AMINOACYL-TRNA SYNTHETASE

THERMUS THERMOPHILUS

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	TRNALEU TRANSCRIPT WITH ANTICODON CAG × 1 ZINC ION × 2 MERCURY (II) ION × 1 SULFATE ION × 12 NORVALINE × 1 2'-AMINO-2'-DEOXYADENOSINE × 1 LEUCINE × 1 water × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	TRNALEU TRANSCRIPT WITH ANTICODON CAG × 1 ZINC ION × 2 MERCURY (II) ION × 1 SULFATE ION × 13 NORVALINE × 1 2'-AMINO-2'-DEOXYADENOSINE × 1 LEUCINE × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q7SIE4_THETH
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–878； UniProt 1–878 Author chain D； PDBConstruct 1–878； UniProt 1–878

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2bte
Deposition date deposition_date	2005-05-31
Structure title title	Thermus thermophilus Leucyl-tRNA synthetase complexed with a tRNAleu transcript in the post-editing conformation and a post- transfer editing substrate analogue
Keywords keywords	LIGASE, CLASS I AMINOACYL-TRNA SYNTHETASE EDITING; LIGASE
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2bte__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2bte__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2bte__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	34.42 Å
Rg (electron density)	34.36 Å
Total Rg	34.79 Å
Atom count	8896
Residues	954
Excluded volume	152180 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2bte__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`2bte__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Description description	AMINOACYL-TRNA SYNTHETASE
Molecular weight formula_weight	101170.1 kDa
EC 编号 ec_number	6.1.1.4
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,D
Atom count atom_count	17815

MEKYNPHAIEAKWQRFWEEKGFMKAKDLPGGRGKQYVLVMFPYPSGDLHMGHLKNYTMGDVLARFRRMQGYEVLHPMGWDAFGLPAENAALKFGVHPKDWTYANIRQAKESLRLMGILYDWDREVTTCEPEYYRWNQWIFLKMWEKGLAYRAKGLVNWCPKCQTVLANEQVVEGRCWRHEDTPVEKRELEQWYLRITAYAERLLKDLEGLNWPEKVKAMQRAWIGRSEGAEILFPVEGKEVRIPVFTTRPDTLFGATFLVLAPEHPLTLELAAPEKREEVLAYVEAAKRKTEIERQAEGREKTGVFLGAYALNPATGERIPIWTADYVLFGYGTGAIMAVPAHDQRDYEFARKFGLPIKKVIERPGEPLPEPLERAYEEPGIMVNSGPFDGTESEEGKRKVIAWLEEKGLGKGRVTYRLRDWLISRQRYWGTPIPMVHCEACGVVPVPEEELPVLLPDLKDVEDIRPKGKSPLEAHPEFYETTCPKCGGPAKRDTDTMDTFFDSSWYYLRYTDPHNDRLPFDPEKANAWMPVDQYIGGVEHAVLHLLYSRFFTKFLHDLGMVKVEEPFQGLFTQGMVLAWTDFGPVEVEGSVVRLPEPTRIRLEIPESALSLEDVRKMGAELRPHEDGTLHLWKPAVMSKSKGNGVMVGPFVKEQGADIARITILFAAPPENEMVWTEEGVQGAWRFLNRIYRRVAEDREALLETSGVFQAEALEGKDRELYGKLHETLKKVTEDLEALRFNTAIAALMEFLNALYEYRKDRPVTPVYRTAIRYYLQMLFPFAPHLAEELWHWFWPDSLFEAGWPELDEKALEKDVVEVAVQVNGRVRGTIHIPKDAPLEVARAEALKVRNVRAHLEGKEVVKEIYVPGKILNLVVRG

Source Source

Source organism organism	THERMUS THERMOPHILUS
NCBI taxonomy ID ncbi_taxonomy_id	274
Host organism host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	TRNALEU TRANSCRIPT WITH ANTICODON CAG
Molecular weight formula_weight	26898.0 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,E

GCCGGGGUGGCGGAAUGGGUAGACGCGCAUGACUCAGGAUCAUGUGCGCAAGCGUGCGGGUUCAAGUCCCGCCCCCGGCACCA

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 4 Entity 4 non-polymer

Description description	MERCURY (II) ION
Molecular weight formula_weight	200.6 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	25

Entity 6 Entity 6 non-polymer

Description description	NORVALINE
Molecular weight formula_weight	117.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 7 Entity 7 non-polymer

Description description	2'-AMINO-2'-DEOXYADENOSINE
Molecular weight formula_weight	266.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 8 Entity 8 non-polymer

Description description	LEUCINE
Molecular weight formula_weight	131.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 9 Entity 9 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	18

▼

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

Domain ID domain_id	2bteA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	2bteA02
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	740 — Isoleucyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Valyl/Leucyl/Isoleucyl-tRNA synthetase, editing domain

Domain ID domain_id	2bteA03
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	210 — Leucyl-tRNA synthetase, domain 3
Homologous superfamily homologous superfamily	10 — Leucyl-tRNA synthetase, domain 3

Domain ID domain_id	2bteA04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	730 — Isoleucyl-tRNA Synthetase; Domain 1
Homologous superfamily homologous superfamily	10 — Isoleucyl-tRNA Synthetase; Domain 1

Domain ID domain_id	2bteA05
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	20 — Ubiquitin-like (UB roll)
Homologous superfamily homologous superfamily	590 —

Domain ID domain_id	2bteD01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	2bteD02
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	740 — Isoleucyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Valyl/Leucyl/Isoleucyl-tRNA synthetase, editing domain

Domain ID domain_id	2bteD03
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	210 — Leucyl-tRNA synthetase, domain 3
Homologous superfamily homologous superfamily	10 — Leucyl-tRNA synthetase, domain 3

Domain ID domain_id	2bteD04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	730 — Isoleucyl-tRNA Synthetase; Domain 1
Homologous superfamily homologous superfamily	10 — Isoleucyl-tRNA Synthetase; Domain 1

Domain ID domain_id	2bteD05
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	20 — Ubiquitin-like (UB roll)
Homologous superfamily homologous superfamily	590 —

▶

Unit-cell length a length_a	204.121 Å
Unit-cell length b length_b	125.705 Å
Unit-cell length c length_c	175.432 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	120.86 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	2.900 Å
Low-resolution limit resolution_low	24.890 Å
R factor r_factor	0.2170
R_work r_work	0.2170
R_free r_free	0.2530

Thermus thermophilus Leucyl-tRNA synthetase complexed with a tRNAleu transcript in the post-editing conformation and a post- transfer editing substrate analogue

1. Protein Identity and Related Structures Protein Identity & Related Structures

AMINOACYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2bte__assembly_1__model_1

2bte__assembly_1__model_1 | I(q)

2bte__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 water

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

7. Citations (1)

Thermus thermophilus Leucyl-tRNA synthetase complexed with a tRNAleu transcript in the post-editing conformation and a post- transfer editing substrate analogue

1. Protein Identity and Related Structures Protein Identity & Related Structures

AMINOACYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2bte__assembly_1__model_1

2bte__assembly_1__model_1 | I(q)

2bte__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 water

6. Fold Classification (SCOP + CATH) 10 domains

CATH v4.4 (10 domains)

7. Citations (1)