SAXSdb — 2fdc

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

UvrABC system protein B

Bacillus caldotenax

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 1–657	Not recorded	5'-D(PCPGPGPCPTPCPCPAPTPCPTPCPTPAPCPCPGPCPAPA)-3' × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；20mM MgCl2, 14% PEG3000, 80mM sodium citrate pH 5.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 3.30 Å R-free 0.258
2	Protein–DNA Monomer Protein × 1 DNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain B； UniProt 1–657	Not recorded	5'-D(PCPGPGPCPTPCPCPAPTPCPTPCPTPAPCPCPGPCPAPA)-3' × 1 FLQ N-[6-(ACETYLAMINO)HEXYL]-3',6'-DIHYDROXY-3-OXO-3H-SPIRO[2-BENZOFURAN-1,9'-XANTHENE]-6-CARBOXAMIDE × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；20mM MgCl2, 14% PEG3000, 80mM sodium citrate pH 5.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 3.30 Å R-free 0.258

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 2FDC	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1D9X CRYSTAL STRUCTURE OF THE DNA REPAIR PROTEIN UVRB Deposited 1999-10-30	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–657（657 aa）	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9；295 K；8 mg/ml UvrB, 500 mM NaCl, 14-18% PEG 6000, 10 mM ZnCl2, 100 mM Bicine pH 9, pH 9.0, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.60 Å R-free 0.324
1D9Z CRYSTAL STRUCTURE OF THE DNA REPAIR PROTEIN UVRB IN COMPLEX WITH ATP Deposited 1999-10-30	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–657（657 aa）	Not recorded	MG MAGNESIUM ION × 1 ZN ZINC ION × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 9；295 K；8 mg/ml UvrB, 500 mM NaCl, 14-18% PEG 6000, 10 mM ZnCl2, 100 mM Bicine pH 9, pH 9.0, VAPOR DIFFUSION, temperature 295K X-ray crystallization conditions Soaking；pH 9；295 K；5 mM ATP 5 mM MgCl2 500 mM NaCl, 14-18% PEG 6000, 10 mM ZnCl2, 100 mM Bicine pH 9, pH 9.0, Soaking, temperature 295K	Resolution 3.15 Å R-free 0.335
1T5L Crystal structure of the DNA repair protein UvrB point mutant Y96A revealing a novel fold for domain 2 Deposited 2004-05-04	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–657（657 aa）	Mutation：Y96A	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；298 K；PEG 6000, Tris, ZnCl2, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.60 Å R-free 0.287
1T5L Crystal structure of the DNA repair protein UvrB point mutant Y96A revealing a novel fold for domain 2 Deposited 2004-05-04	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1–657（657 aa）	Mutation：Y96A	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；298 K；PEG 6000, Tris, ZnCl2, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.60 Å R-free 0.287
6O8E Crystal structure of UvrB bound to duplex DNA with ADP Deposited 2019-03-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 2–593（592 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 PO4 PHOSPHATE ION × 3 MG MAGNESIUM ION × 2 CL CHLORIDE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；293 K；100 mM Bis-Tris, pH 6.5, 100 mM ammonium acetate, 17-19% w/v PEG8000	Resolution 2.61 Å R-free 0.270
6O8E Crystal structure of UvrB bound to duplex DNA with ADP Deposited 2019-03-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 2–593（592 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 PO4 PHOSPHATE ION × 1 MG MAGNESIUM ION × 2 CL CHLORIDE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；293 K；100 mM Bis-Tris, pH 6.5, 100 mM ammonium acetate, 17-19% w/v PEG8000	Resolution 2.61 Å R-free 0.270
6O8F Crystal structure of UvrB bound to duplex DNA Deposited 2019-03-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 2–593（592 aa）	Not recorded	CL CHLORIDE ION × 1 MG MAGNESIUM ION × 3 ACT ACETATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；293 K；100 mM Bis-Tris, pH 6.5, 100 mM ammonium acetate, 17-19% w/v PEG8000	Resolution 2.81 Å R-free 0.264
6O8F Crystal structure of UvrB bound to duplex DNA Deposited 2019-03-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 2–593（592 aa）	Not recorded	MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；293 K；100 mM Bis-Tris, pH 6.5, 100 mM ammonium acetate, 17-19% w/v PEG8000	Resolution 2.81 Å R-free 0.264
6O8G Crystal structure of UvrB bound to fully duplex DNA Deposited 2019-03-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 2–593（592 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 NA SODIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；0.1 M HEPES, pH 7.5, 0.02 M magnesium chloride, 20-22% poly(acryl acid sodium salt) 5100	Resolution 2.64 Å R-free 0.274
6O8G Crystal structure of UvrB bound to fully duplex DNA Deposited 2019-03-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 2–593（592 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 CL CHLORIDE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；0.1 M HEPES, pH 7.5, 0.02 M magnesium chloride, 20-22% poly(acryl acid sodium salt) 5100	Resolution 2.64 Å R-free 0.274
6O8G Crystal structure of UvrB bound to fully duplex DNA Deposited 2019-03-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain C 2–593（592 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；0.1 M HEPES, pH 7.5, 0.02 M magnesium chloride, 20-22% poly(acryl acid sodium salt) 5100	Resolution 2.64 Å R-free 0.274
6O8H Crystal structure of UvrB mutant bound to duplex DNA Deposited 2019-03-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 2–593（592 aa）	Not recorded	SO4 SULFATE ION × 2 CL CHLORIDE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；0.2 M potassium sulfate, 18-20% PEG3350, 2 mM ADP, 5 mM magnesium chloride	Resolution 2.39 Å R-free 0.277

7 other PDB entries and 12 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	UVRB_BACCA
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–658； UniProt 1–657 Author chain B； PDBConstruct 1–658； UniProt 1–657

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2fdc
Deposition date deposition_date	2005-12-13
Structure title title	Structural Basis of DNA Damage Recognition and Processing by UvrB: crystal structure of a UvrB/DNA complex
Keywords keywords	Protein-DNA complex, UvrB, UvrC, UvrD, UvrA, NER, nucleotide excision repair, DNA repair, DNA BINDING PROTEIN-DNA COMPLEX; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	49.48 Å
Radius of gyration Rg (electron density) rg_electron	50.08 Å
Forward intensity I(0) i0	259231000.00
Molecular weight molecular_weight	130490.0 kDa
Excluded volume excluded_volume	162210 Å³
Envelope volume envelope_volume	235540 Å³
Hydration-shell volume shell_volume	40778 Å³
Envelope diameter envelope_diameter	179.5 Å
Shell Rg shell_rg	51.62 Å
Envelope Rg envelope_rg	48.54 Å
Shape Rg shape_rg	50.08 Å
Total Rg total_rg	50.16 Å
Total atoms total_atoms	9178
Residues n_residues	1107
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	167.4 Å
Rg (real space) rg_real	50.14 Å
Rg uncertainty (real space) rg_real_error	1.92 Å
I(0) (real space) i0_real	2.5920e+08
I(0) uncertainty (real space) i0_real_error	5.5920e+06
Rg (reciprocal space) rg_reciprocal	49.48 Å
I(0) (reciprocal space) i0_reciprocal	259000000.0000
Solution quality estimate total_estimate	0.7575
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	31.4 Å
Skewness Skewness skewness	0.380
Kurtosis Kurtosis kurtosis	-0.731
Angular range angular_range	— – 0.1600 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	10860000.0000
Real-space data points n_real_points	33
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.631; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.468; Smooth: 0.481

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	5'-D(PCPGPGPCPTPCPCPAPTPCPTPCPTPAPCPCPGPCPAPA)-3'
Molecular weight formula_weight	6014.9 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,D
Atom count atom_count	9178

CGGCTCCATCTCTACCGCAA

Entity 2 Entity 2 polymer

Description description	UvrABC system protein B
Molecular weight formula_weight	75587.0 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

VEGRFQLVAPYEPQGDQPQAIAKLVDGLRRGVKHQTLLGATGTGKTFTISNVIAQVNKPTLVIAHNKTLAGQLYSELKEFFPHNAVEYFVSYYDYYQPEAYVPQTDTYIEKDAKINDEIDKLRHSATSALFERRDVIIVASVSCIYGLGSPEEYRELVVSLRVGMEIERNALLRRLVDIQYDRNDIDFRRGTFRVRGDVVEIFPASRDEHCIRVEFFGDEIERIREVDALTGEVLGEREHVAIFPASHFVTREEKMRLAIQNIEQELEERLAELRAQGKLLEAQRLEQRTRYDLEMMREMGFCSGIENYSRHLALRPPGSTPYTLLDYFPDDFLIIVDESHVTLPQLRGMYNGDRARKQVLVDHGFRLPSALDNRPLTFEEFEQKINQIIYVSATPGPYELEHSPGVVEQIIRPTGLLDPTIDVRPTKGQIDDLIGEIRERVERNERTLVTTLTKKMAEDLTDYLKEAGIKVAYLHSEIKTLERIEIIRDLRLGKYDVLVGINLLREGLDIPEVSLVAILDADKEGFLRSERSLIQTIGRAARNANGHVIMYADTITKSMEIAIQETKRRRAIQEEYNRKHGIVPRTVKKEIRDVIRATYAAEETEMYEAKPAAAMTKQEREELIRTLEAEMKEAAKALDFERAAQLRDIIFELKAEG

来源 Source

来源生物 organism	Bacillus caldotenax
NCBI Class编号 ncbi_taxonomy_id	1395
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	N-[6-(ACETYLAMINO)HEXYL]-3',6'-DIHYDROXY-3-OXO-3H-SPIRO[2-BENZOFURAN-1,9'-XANTHENE]-6-CARBOXAMIDE
Molecular weight formula_weight	516.5 kDa
Source method src_method	syn
Copy count entity_count	1

▼

7. Fold Classification (SCOP + CATH) 10 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d2fdca1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d2fdca2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d2fdcb1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d2fdcb2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

CATH v4.4 (6 domains)

Domain ID domain_id	2fdcA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	2fdcA03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	2fdcB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	2fdcB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	2060 — Penicillin-binding protein 1b fold
Homologous superfamily homologous superfamily	10 — Penicillin-binding protein 1b domain

Domain ID domain_id	2fdcB03
Class class	6 — Special
Architecture architecture	10 — Helix non-globular
Topology topology	140 — Helix Hairpins
Homologous superfamily homologous superfamily	240 —

Domain ID domain_id	2fdcB04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

▶

8. Citations (1)

▶

Unit-cell length a length_a	153.265 Å
Unit-cell length b length_b	153.265 Å
Unit-cell length c length_c	160.170 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 32 2 1
Space-group number int_tables_number	154
Crystal system crystal_system	—

Resolution resolution	3.300 Å
Low-resolution limit resolution_low	10.000 Å
R factor r_factor	0.2100
R_work r_work	0.2050
R_free r_free	0.2580

fit	/app/data/saxs_computation/fd/2fdc/2fdc.fit
pddf	/app/data/pr_computation/fd/2fdc/2fdc.pr.out
profile	/app/data/saxs_computation/fd/2fdc/2fdc.dat

Structural Basis of DNA Damage Recognition and Processing by UvrB: crystal structure of a UvrB/DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

UvrABC system protein B

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

7. Fold Classification (SCOP + CATH) 10 domains

SCOP 2.08 (4 domains)

CATH v4.4 (6 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)