SAXSdb — 4ay2

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

PROBABLE ATP-DEPENDENT RNA HELICASE DDX58

OrganismNot specified

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	;5'-R-PPP(GPGPCPGPCPGPGPCPUPUPCPGPGPCP CPGPCPGPCP*C)-3' ; × 1 ZINC ION × 1 ADENOSINE-5'-DIPHOSPHATE × 1 MAGNESIUM ION × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DDX58_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–687； UniProt 239–925

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4ay2
Deposition date deposition_date	2012-06-17
Structure title title	Capturing 5' tri-phosphorylated RNA duplex by RIG-I
Keywords keywords	HYDROLASE-RNA COMPLEX, INNATE IMMUNITY; HYDROLASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4ay2__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4ay2__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4ay2__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	29.36 Å
Rg (electron density)	29.10 Å
Total Rg	29.70 Å
Atom count	5472
Residues	647
Excluded volume	96447 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4ay2__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	PROBABLE ATP-DEPENDENT RNA HELICASE DDX58
Molecular weight formula_weight	78686.8 kDa
EC 编号 ec_number	3.6.4.13
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	5542

SPFKPRNYQLELALPAMKGKNTIICAPTGCGKTFVSLLICEHHLKKFPQGQKGKVVFFANQIPVYEQNKSVFSKYFERHGYRVTGISGATAENVPVEQIVENNDIIILTPQILVNNLKKGTIPSLSIFTLMIFDECHNTSKQHPYNMIMFNYLDQKLGGSSGPLPQVIGLTASVGVGDAKNTDEALDYICKLCASLDASVIATVKHNLEELEQVVYKPQKFFRKVESRISDKFKYIIAQLMRDTESLAKRICKDLENLSQIQNREFGTQKYEQWIVTVQKACMVFQMPDKDEESRICKALFLYTSHLRKYNDALIISEHARMKDALDYLKDFFSNVRAAGFDEIEQDLTQRFEEKLQELESVSRDPSNENPKLEDLCFILQEEYHLNPETITILFVKTRALVDALKNWIEGNPKLSFLKPGILTGRGKTNQNTGMTLPAQKCILDAFKASGDHNILIATSVADEGIDIAQCNLVILYEYVGNVIKMIQTRGRGRARGSKCFLLTSNAGVIEKEQINMYKEKMMNDSILRLQTWDEAVFREKILHIQTHEKFIRDSQEKPKPVPDKENKKLLCRKCKALACYTADVRVIEDCHYTVLGDAFKECFVSRPHPKPKQFSSFEKRAKIFCARQNCSHDWGIHVKYKTFEIPVIKIESFVVEDIATGVQTLYSKWKDFHFEKIPFDPAEMSK

Entity 2 Entity 2 polymer

Description description	;5'-R-PPP(GPGPCPGPCPGPGPCPUPUPCPGPGPCP CPGPCPGPCP*C)-3' ;
Molecular weight formula_weight	6580.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C

GGCGCGGCUUCGGCCGCGCC

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	ADENOSINE-5'-DIPHOSPHATE
Molecular weight formula_weight	427.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	70

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	4ay2A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4ay2A02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4ay2A03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1320 — phosphoenolpyruvate carboxylase, domain 3
Homologous superfamily homologous superfamily	30 —

Domain ID domain_id	4ay2A04
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	150 — Metal Binding Protein, Guanine Nucleotide Exchange Factor; Chain A
Homologous superfamily homologous superfamily	30 — RIG-I-like receptor, C-terminal regulatory domain

▶

Unit-cell length a length_a	47.745 Å
Unit-cell length b length_b	76.156 Å
Unit-cell length c length_c	221.222 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	24.900 Å
R factor r_factor	0.2215
R_work r_work	0.2182
R_free r_free	0.2858

Capturing 5' tri-phosphorylated RNA duplex by RIG-I

1. Protein Identity and Related Structures Protein Identity & Related Structures

PROBABLE ATP-DEPENDENT RNA HELICASE DDX58

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4ay2__assembly_1__model_1

4ay2__assembly_1__model_1 | I(q)

4ay2__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Capturing 5' tri-phosphorylated RNA duplex by RIG-I

1. Protein Identity and Related Structures Protein Identity & Related Structures

PROBABLE ATP-DEPENDENT RNA HELICASE DDX58

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4ay2__assembly_1__model_1

4ay2__assembly_1__model_1 | I(q)

4ay2__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)