5dtd

Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

Method: X-RAY DIFFRACTION

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-binding protein Fis

Escherichia coli

UniProt P0A6R3

State in the Current Structure

Assembly Physical composition Protein state Molecular copy count Associated components Data consistency
1 Protein–DNA Homooligomer Protein 2 DNA 2 DNA (27-MER) × 1 DNA (27-MER) × 1 water × 3 Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence
UniProt name FIS_ECOLI
Isoform
PDB entities 1
Chains and sequence ranges Author chain A; PDBConstruct 1–98; UniProt 1–98 Author chain B; PDBConstruct 1–98; UniProt 1–98

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

2. Structure Basics 2. Structure Basics

Entry ID entry_id5dtd
Deposition date deposition_date2015-09-17
Structure title titleCrystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
Keywords keywordsProtein-DNA complex, HTH domain, DNA bending, indirect recognition, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method methodX-RAY DIFFRACTION

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5dtd__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5dtd__assembly_1__model_1 | I(q)

10-2 10-1 106 107 q (1/Angstrom) I(q)
100 plotted points; both axes use logarithmic scales.

5dtd__assembly_1__model_1 | P(r) · Pending

The new assembly/model P(r) has not been calculated yet This placeholder does not display legacy data r (Angstrom) P(r)
P(r) will be calculated and displayed separately for the same assembly/model.
Rg(Guinier)25.24 Å
Rg (electron density)23.59 Å
Total Rg24.31 Å
Atom count2606
Residues243
Excluded volume43071 ų
Maximum q0.500 Å⁻¹
Assembly Model Structure unit Oligomeric description Status CRYSOL Actions
1 1 5dtd__assembly_1__model_1 tetrameric (4) Success 4.1.3-1-20251215 (887e7ef) View Download

4. Crystallography and Experiment 4. Crystallography & Experiment

5. Entities and Polymers Entities & Polymers (4)

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

Domain ID domain_id5dtdA00
Class class1 — Mainly Alpha
Architecture architecture10 — Orthogonal Bundle
Topology topology10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily60 — Homeodomain-like
Domain ID domain_id5dtdB00
Class class1 — Mainly Alpha
Architecture architecture10 — Orthogonal Bundle
Topology topology10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily60 — Homeodomain-like

7. Citations (1)