5xh6

Crystal structure of the Acidaminococcus sp. BV3L6 Cpf1 RVR variant in complex with crRNA and target DNA (TATA PAM)

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cpf1

Acidaminococcus sp. (strain BV3L6)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Monomer	Protein 1 DNA 2 RNA 1	crRNA × 1 Target DNA strand × 1 Non-target DNA strand × 1 SODIUM ION × 5 CHLORIDE ION × 1 1,2-ETHANEDIOL × 18 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	CPF1_ACISB
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 4–1310； UniProt 1–1307

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5xh6
Deposition date deposition_date	2017-04-19
Structure title title	Crystal structure of the Acidaminococcus sp. BV3L6 Cpf1 RVR variant in complex with crRNA and target DNA (TATA PAM)
Keywords keywords	nuclease, HYDROLASE-RNA-DNA complex; HYDROLASE/RNA/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5xh6__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5xh6__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5xh6__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.33 Å
Rg (electron density)	37.23 Å
Total Rg	37.57 Å
Atom count	12088
Residues	1363
Excluded volume	210170 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5xh6__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	CRISPR-associated endonuclease Cpf1
Molecular weight formula_weight	151784.4 kDa
EC 编号 ec_number	3.1.-.-
Mutation mutation	S542R, K548V, N552R
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	12831

GSHMTQFEGFTNLYQVSKTLRFELIPQGKTLKHIQEQGFIEEDKARNDHYKELKPIIDRIYKTYADQCLQLVQLDWENLSAAIDSYRKEKTEETRNALIEEQATYRNAIHDYFIGRTDNLTDAINKRHAEIYKGLFKAELFNGKVLKQLGTVTTTEHENALLRSFDKFTTYFSGFYENRKNVFSAEDISTAIPHRIVQDNFPKFKENCHIFTRLITAVPSLREHFENVKKAIGIFVSTSIEEVFSFPFYNQLLTQTQIDLYNQLLGGISREAGTEKIKGLNEVLNLAIQKNDETAHIIASLPHRFIPLFKQILSDRNTLSFILEEFKSDEEVIQSFCKYKTLLRNENVLETAEALFNELNSIDLTHIFISHKKLETISSALCDHWDTLRNALYERRISELTGKITKSAKEKVQRSLKHEDINLQEIISAAGKELSEAFKQKTSEILSHAHAALDQPLPTTLKKQEEKEILKSQLDSLLGLYHLLDWFAVDESNEVDPEFSARLTGIKLEMEPSLSFYNKARNYATKKPYSVEKFKLNFQMPTLARGWDVNVEKNRGAILFVKNGLYYLGIMPKQKGRYKALSFEPTEKTSEGFDKMYYDYFPDAAKMIPKCSTQLKAVTAHFQTHTTPILLSNNFIEPLEITKEIYDLNNPEKEPKKFQTAYAKKTGDQKGYREALCKWIDFTRDFLSKYTKTTSIDLSSLRPSSQYKDLGEYYAELNPLLYHISFQRIAEKEIMDAVETGKLYLFQIYNKDFAKGHHGKPNLHTLYWTGLFSPENLAKTSIKLNGQAELFYRPKSRMKRMAHRLGEKMLNKKLKDQKTPIPDTLYQELYDYVNHRLSHDLSDEARALLPNVITKEVSHEIIKDRRFTSDKFFFHVPITLNYQAANSPSKFNQRVNAYLKEHPETPIIGIDRGERNLIYITVIDSTGKILEQRSLNTIQQFDYQKKLDNREKERVAARQAWSVVGTIKDLKQGYLSQVIHEIVDLMIHYQAVVVLENLNFGFKSKRTGIAEKAVYQQFEKMLIDKLNCLVLKDYPAEKVGGVLNPYQLTDQFTSFAKMGTQSGFLFYVPAPYTSKIDPLTGFVDPFVWKTIKNHESRKHFLEGFDFLHYDVKTGDFILHFKMNRNLSFQRGLPGFMPAWDIVFEKNETQFDAKGTPFIAGKRIVPVIENHRFTGRYRDLYPANELIALLEEKGIVFRDGSNILPKLLENDDSHAIDTMVALIRSVLQMRNSNAATGEDYINSPVRDLNGVCFDSRFQNPEWPMDADANGAYHIALKGQLLLNHLKESKDLKLQNGISNQDWLAYIQELRN

Source Source

Source organism organism	Acidaminococcus sp. (strain BV3L6)
NCBI taxonomy ID ncbi_taxonomy_id	1111120
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	crRNA
Molecular weight formula_weight	13756.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

AAUUUCUACUCUUGUAGAUGGAAAUUAGGUGCGCUUGGCAACC

Entity 3 Entity 3 polymer

Description description	Target DNA strand
Molecular weight formula_weight	10434.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GGTTGCCAAGCGCACCTAATTTCCTATAGGACTG

Entity 4 Entity 4 polymer

Description description	Non-target DNA strand
Molecular weight formula_weight	3004.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CAGTCCTATA

Entity 5 Entity 5 non-polymer

Description description	SODIUM ION
Molecular weight formula_weight	23.0 kDa
Source method src_method	syn
Copy count entity_count	5

Entity 6 Entity 6 non-polymer

Description description	CHLORIDE ION
Molecular weight formula_weight	35.5 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 non-polymer

Description description	1,2-ETHANEDIOL
Molecular weight formula_weight	62.1 kDa
Source method src_method	syn
Copy count entity_count	18

Entity 8 Entity 8 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	659

▶

Unit-cell length a length_a	81.162 Å
Unit-cell length b length_b	133.676 Å
Unit-cell length c length_c	199.633 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.000 Å
Low-resolution limit resolution_low	39.990 Å
R factor r_factor	0.1767
R_work r_work	0.1750
R_free r_free	0.2099

Crystal structure of the Acidaminococcus sp. BV3L6 Cpf1 RVR variant in complex with crRNA and target DNA (TATA PAM)

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cpf1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5xh6__assembly_1__model_1

5xh6__assembly_1__model_1 | I(q)

5xh6__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 water

7. Citations (1)

Crystal structure of the Acidaminococcus sp. BV3L6 Cpf1 RVR variant in complex with crRNA and target DNA (TATA PAM)

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cpf1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5xh6__assembly_1__model_1

5xh6__assembly_1__model_1 | I(q)

5xh6__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 water

7. Citations (1)