SAXSdb — 6xzd

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Polymerase acidic protein

Influenza C virus (strain C/Johannesburg/1/1966)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 6 RNA 1	;RNA (5'-R(APGPUPAPGPAPAPAPCPAPAPGPGPGPCPCPCPUPGPC)-3') ; × 1 RNA-directed RNA polymerase catalytic subunit × 2 （Q9IMP4） Polymerase basic protein 2 × 2 （Q9IMP3）	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PA_INCJH
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain AP1； PDBConstruct 1–709； UniProt 1–709 Author chain DP1； PDBConstruct 1–709； UniProt 1–709

RNA-directed RNA polymerase catalytic subunit

Influenza C virus (strain C/Johannesburg/1/1966)

UniProt Q9IMP4

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 6 RNA 1	;RNA (5'-R(APGPUPAPGPAPAPAPCPAPAPGPGPGPCPCPCPUPGPC)-3') ; × 1 Polymerase acidic protein × 2 （Q9IMP5） Polymerase basic protein 2 × 2 （Q9IMP3）	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RDRP_INCJH
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain BP1； PDBConstruct 1–754； UniProt 1–754 Author chain EP1； PDBConstruct 1–754； UniProt 1–754

Polymerase basic protein 2

Influenza C virus (strain C/Johannesburg/1/1966)

UniProt Q9IMP3

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 6 RNA 1	;RNA (5'-R(APGPUPAPGPAPAPAPCPAPAPGPGPGPCPCPCPUPGPC)-3') ; × 1 Polymerase acidic protein × 2 （Q9IMP5） RNA-directed RNA polymerase catalytic subunit × 2 （Q9IMP4）	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PB2_INCJH
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain CP1； PDBConstruct 1–774； UniProt 1–774 Author chain FP1； PDBConstruct 1–774； UniProt 1–774

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	6xzd
Deposition date deposition_date	2020-02-04
Structure title title	Influenza C virus polymerase complex without chicken ANP32A - Subclass 2
Keywords keywords	Influenza Polymerase, ANP32, replication, RNA-dependent RNA polymerase, VIRAL PROTEIN; VIRAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

6xzd__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

6xzd__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

6xzd__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	56.98 Å
Rg (electron density)	56.75 Å
Total Rg	56.89 Å
Atom count	63749
Residues	3939
Excluded volume	568640 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`6xzd__assembly_1__model_1`	heptameric （7）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	;RNA (5'-R(APGPUPAPGPAPAPAPCPAPAPGPGPGPCPCPCPUPGPC)-3') ;
Molecular weight formula_weight	14901.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	IN1
Atom count atom_count	63749

AGUAGAAACAAGGGUAUUUUUCUUUACUAGUCUACCCUGCUUUUGCU

Entity 2 Entity 2 polymer

Description description	Polymerase acidic protein
Molecular weight formula_weight	82025.5 kDa
EC 编号 ec_number	3.1.-.-
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	AP1,DP1

MSKTFAEIAEAFLEPEAVRIAKEAVEEYGDHERKIIQIGIHFQVCCMFCDEYLSTNGSDRFVLIEGRKRGTAVSLQNELCKSYDLEPLPFLCDIFDREEKQFVEIGITRKADDSYFQSKFGKLGNSCKIFVFSYDGRLDKNCEGPMEEQKLRIFSFLATAADFLRKENMFNEIFLPDNEETIIEMKKGKTFLELRDESVPLPFQTYEQMKDYCEKFKGNPRELASKVSQMQSNIKLPIKHYEQNKFRQIRLPKGPMAPYTHKFLMEEAWMFTKISDPERSRAGEILIDFFKKGNLSAIRPKDKPLQGKYPIHYKNLWNQIKAAIADRTMVINENDHSEFLGGIGRASKKIPEISLTQDVITTEGLKQSENKLPEPRSFPRWFNAEWMWAIKDSDLTGWVPMAEYPPADNELEDYAEHLNKTMEGVLQGTNCAREMGKCILTVGALMTECRLFPGKIKVVPIYARSKERKSMQEGLPVPSEMDCLFGICVKSKSHLNKDDGMYTIITFEFSIREPNLEKHQKYTVFEAGHTTVRMKKGESVIGREVPLYLYCRTTALSKIKNDWLSKARRCFITTMDTVETICLRESAKAEENLVEKTLNEKQMWIGKKNGELIAQPLREALRVQLVQQFYFCIYNDSQLEGFCNEQKKILMALEGDKKNKSSFGFNPEGLLEKIEECLINNPMCLFMAQRLNELVIEASKRGAKFFKTD

Source Source

Source organism organism	Influenza C virus (strain C/Johannesburg/1/1966)
NCBI taxonomy ID ncbi_taxonomy_id	100673
Host organism host_organism	Spodoptera frugiperda

Entity 3 Entity 3 polymer

Description description	RNA-directed RNA polymerase catalytic subunit
Molecular weight formula_weight	86145.9 kDa
EC 编号 ec_number	2.7.7.48
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	BP1,EP1

MEINPYLMFLNNDVTSLISTTYPYTGPPPMSHGSSTKYTLETIKRTYDYSRTSVEKTSKVFNIPRRKFCNCLEDKDELVKPTGNVDISSLLGLAEMMEKRMGEGFFKHCVMEAETEILKMHFSRLTEGRQTYDWTSERNMPAATALQLTVDAIKETEGPFKGTTMLEYCNKMIEMLDWKEIKFKKVKTVVRREKDKRSGKEIKTKVPVMGIDSIKHDEFLIRALTINTMAKDGERGKLQRRAIATPGMIVRPFSKIVETVAQKICEKLKESGLPVGGNEKKAKLKTTVTSLNARMNSDQFAVNITGDNSKWNECQQPEAYLALLAYITKDSSDLMKDLCSVAPVLFCNKFVKLGQGIRLSNKRKTKEVIIKAEKMGKYKNLMREEYKNLFEPLEKYIQKDVCFLPGGMLMGMFNMLSTVLGVSTLCYMDEELKAKGCFWTGLQSSDDFVLFAVASNWSNIHWTIRRFNAVCKLIGINMSLEKSYGSLPELFEFTSMFFDGEFVSNLAMELPAFTTAGVNEGVDFTAAMSIIKTNMINNSLSPSTALMALRICLQEFRATYRVHPWDSRVKGGRMKIINEFIKTIENKDGLLIADGGKLMNNISTLHIPEEVLKFEKMDEQYRNRVFNPKNPFTNFDKTIDIFRAHGPIRVEENEAVVSTHSFRTRANRTLLNTDMRAMMAEEKRYQMVCDMFKSVFESADINPPIGAMSIGEAIEEKLLERAKMKRDIGAIEDSEYEEIKDIIRDAKKARLESR

Source Source

Source organism organism	Influenza C virus (strain C/Johannesburg/1/1966)
NCBI taxonomy ID ncbi_taxonomy_id	100673
Host organism host_organism	Spodoptera frugiperda

Entity 4 Entity 4 polymer

Description description	Polymerase basic protein 2
Molecular weight formula_weight	87949.4 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	CP1,FP1

MSLLLTIAKEYKRLCQDAKAAQMMTVGTVSNYTTFKKWTTSRKEKNPSLRMRWAMSSKFPIIANKRMLEEAQIPKEHNNVALWEDTEDVSKRDHVLASASCINYWNFCGPCVNNSEVIKEVYKSRFGRLERRKEIMWKELRFTLVDRQRRRVDTQPVEQRLRTGEIKDLQMWTLFEDEAPLASKFILDNYGLVKEMRSKFANKPLNKEVVAHMLEKQFNPESRFLPVFGAIRPERMELIHALGGETWIQEANTAGISNVDQRKNDIRAVCRKVCLAANASIMNAKSKLVEYIKSTSMRIGETERKLEELILETDDVSPEVTLCKSALGGQLGKTLSFGPMLLKKISGSGVKVKDTVYIQGVRAVQFEYWSEQEEFYGEYKSATALFSRKERSLEWITIGGGINEDRKRLLAMCMIFCRDGDYFKDAPATITMADLSTKLGREIPYQYVMMNWIQKSEDNLEALLYSRGIVETNPGKMGSSMGIDGSKRAIKSLRAVTIQSGKIDMPESKEKIHLELSDNLEAFDSSGRIVATILDLPSDKKVTFQDVSFQHPDLAVLRDEKTAITKGYEALIKRLGTGDNDIPSLIAKKDYLSLYNLPEVKLMAPLIRPNRKGVYSRVARKLVSTQVTTGHYSLHELIKVLPFTYFAPKQGMFEGRLFFSNDSFVEPGVNNNVFSWSKADSSKIYCHGIAIRVPLVVGDEHMDTSLALLEGFSVCENDPRAPMVTRQDLIDVGFGQKVRLFVGQGSVRTFKRTASQRAASSDVNKNVKKIKMSN

Source Source

Source organism organism	Influenza C virus (strain C/Johannesburg/1/1966)
NCBI taxonomy ID ncbi_taxonomy_id	100673
Host organism host_organism	Spodoptera frugiperda

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	3.40 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	169000

Influenza C virus polymerase complex without chicken ANP32A - Subclass 2

1. Protein Identity and Related Structures Protein Identity & Related Structures

Polymerase acidic protein

State in the Current Structure

Other States of the Same Protein in the Database

RNA-directed RNA polymerase catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

Polymerase basic protein 2

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

6xzd__assembly_1__model_1

6xzd__assembly_1__model_1 | I(q)

6xzd__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

7. Citations (1)

Influenza C virus polymerase complex without chicken ANP32A - Subclass 2

1. Protein Identity and Related Structures Protein Identity & Related Structures

Polymerase acidic protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

RNA-directed RNA polymerase catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Polymerase basic protein 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

6xzd__assembly_1__model_1

6xzd__assembly_1__model_1 | I(q)

6xzd__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

7. Citations (1)