SAXSdb — 7pel

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Pol protein

Simian T-lymphotropic virus 1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 6 DNA 4	;Isoform 3 of PC4 and SFRS1-interacting protein,Isoform Gamma-2 of Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform ; × 2 （O75475,Q13362） ;DNA (5'-D(APCPTPGPTPGPTPTPTPGPGPCPGPCPTPTPCPTPCPTPC)-3') ; × 2 ;DNA (5'-D(GPAPGPAPGPAPAPGPCPGPCPCPAPAPAPCPAPCPA)-3') ; × 2 ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q4QY51_9STL1
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 5–301； UniProt 600–896 Author chain B； PDBConstruct 5–301； UniProt 600–896 Author chain D； PDBConstruct 5–301； UniProt 600–896 Author chain E； PDBConstruct 5–301； UniProt 600–896

;Isoform 3 of PC4 and SFRS1-interacting protein,Isoform Gamma-2 of Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform ;

Homo sapiens

UniProt O75475

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 6 DNA 4	Pol protein × 4 （Q4QY51） ;DNA (5'-D(APCPTPGPTPGPTPTPTPGPGPCPGPCPTPTPCPTPCPTPC)-3') ; × 2 ;DNA (5'-D(GPAPGPAPGPAPAPGPCPGPCPCPAPAPAPCPAPCPA)-3') ; × 2 ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PSIP1_HUMAN
Isoform	O75475-3
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 2–326； UniProt 1–325 Author chain F； PDBConstruct 2–326； UniProt 1–325

;Isoform 3 of PC4 and SFRS1-interacting protein,Isoform Gamma-2 of Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform ;

Homo sapiens

UniProt Q13362

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 6 DNA 4	Pol protein × 4 （Q4QY51） ;DNA (5'-D(APCPTPGPTPGPTPTPTPGPGPCPGPCPTPTPCPTPCPTPC)-3') ; × 2 ;DNA (5'-D(GPAPGPAPGPAPAPGPCPGPCPCPAPAPAPCPAPCPA)-3') ; × 2 ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	2A5G_HUMAN
Isoform	Q13362-3
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 328–697； UniProt 11–380 Author chain F； PDBConstruct 328–697； UniProt 11–380

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7pel
Deposition date deposition_date	2021-08-10
Structure title title	CryoEM structure of simian T-cell lymphotropic virus intasome in complex with PP2A regulatory subunit B56 gamma
Keywords keywords	integrase, transferase, deltaretrovirus, PP2A, B56, phosphatase, molecular mimicry, host factor, DNA-binding, VIRAL PROTEIN; VIRAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7pel__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7pel__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7pel__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	44.57 Å
Rg (electron density)	46.00 Å
Total Rg	46.02 Å
Atom count	14998
Residues	1744
Excluded volume	262330 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7pel__assembly_1__model_1`	decameric （10）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Pol protein
Molecular weight formula_weight	33885.5 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,D,E
Atom count atom_count	14998

GPEFQLSPAKLHSFTHCGQAALTLHGATTTEALNILHSCHACRKNNPQHQMPRGHIRRGLLPNHIWQGDITHFKYKNTLYRLHVWVDTFSGSVSATHKKRETSSEAISSLLHAIAHLGRPSHINTDNGPAYASQEFQHACTSLAIRHTTHIPYNPTSSGLVERTNGILKTLLYKYFSDNPNLPMDNALSVALWTINHLNVLTHCQKTRWQLHHSPRLPPIPEAKPVTTSKTHWYYFKIPGLNSRQWKGPQRALQEAAGAALIPVSDTAAQWIPWKLLKRAVCPRLAGDTADPKERDHQHHG

Source Source

Source organism organism	Simian T-lymphotropic virus 1
NCBI taxonomy ID ncbi_taxonomy_id	33747
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	;Isoform 3 of PC4 and SFRS1-interacting protein,Isoform Gamma-2 of Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform ;
Molecular weight formula_weight	80394.7 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,F

SMTRDFKPGDLIFAKMKGYPHWPARVDEVPDGAVKPPTNKLPIFFFGTHETAFLGPKDIFPYSENKEKYGKPNKRKGFNEGLWEIDNNPKVKFSSQQAATKQSNASSDVEVEEKETSVSKEDTDHEEKASNEDVTKAVDITTPKAARRGRKRKAEKQVETEEAGVVTTATASVNLKVSPKRGRPAATEVKIPKPRGRPKMVKQPCPSESDIITEEDKSKKKGQEEKQPKKQPKKDEEGQKEEDKPRKEPDKKEGKKEVESKRKNLAKTGVTSTSDSEEEGDDQEGEKKRKGGRNFQTAHRRNMLKGQHEKEAADRKRKQEEQMETEFMVVDAANSNGPFQPVVLLHIRDVPPADQEKLFIQKLRQCCVLFDFVSDPLSDLKWKEVKRAALSEMVEYITHNRNVITEPIYPEVVHMFAVNMFRTLPPSSNPTGAEFDPEEDEPTLEAAWPHLQLVYEFFLRFLESPDFQPNIAKKYIDQKFVLQLLELFDSEDPRERDFLKTTLHRIYGKFLGLRAYIRKQINNIFYRFIYETEHHNGIAELLEILGSIINGFALPLKEEHKIFLLKVLLPLHKVKSLSVYHPQLAYCVVQFLEKDSTLTEPVVMALLKYWPKTHSPKEVMFLNELEEILDVIEPSEFVKIMEPLFRQLAKCVSSPHFQVAERALYYWNNEYIMSLISDNAAKILPIMFPSLYRNSKT

Source Source

Source organism organism	Homo sapiens
Common name common_name	Human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(APCPTPGPTPGPTPTPTPGPGPCPGPCPTPTPCPTPCPTP*C)-3') ;
Molecular weight formula_weight	9221.9 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	K,M

ACTGTGTTTGGCGCTTCTCTCCCGGAGAGA

Entity 4 Entity 4 polymer

Description description	;DNA (5'-D(GPAPGPAPGPAPAPGPCPGPCPCPAPAPAPCPAPCP*A)-3') ;
Molecular weight formula_weight	8593.6 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	L,N

TCTCTCCGGGAGAGAAGCGCCAAACACA

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	7pelA01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	7pelB01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	7pelD01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	7pelE01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.34 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	161921

CryoEM structure of simian T-cell lymphotropic virus intasome in complex with PP2A regulatory subunit B56 gamma

1. Protein Identity and Related Structures Protein Identity & Related Structures

Pol protein

State in the Current Structure

Other States of the Same Protein in the Database

;Isoform 3 of PC4 and SFRS1-interacting protein,Isoform Gamma-2 of Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform ;

State in the Current Structure

Other States of the Same Protein in the Database

;Isoform 3 of PC4 and SFRS1-interacting protein,Isoform Gamma-2 of Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform ;

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7pel__assembly_1__model_1

7pel__assembly_1__model_1 | I(q)

7pel__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

CryoEM structure of simian T-cell lymphotropic virus intasome in complex with PP2A regulatory subunit B56 gamma

1. Protein Identity and Related Structures Protein Identity & Related Structures

Pol protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

;Isoform 3 of PC4 and SFRS1-interacting protein,Isoform Gamma-2 of Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform ;

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

;Isoform 3 of PC4 and SFRS1-interacting protein,Isoform Gamma-2 of Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform ;

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7pel__assembly_1__model_1

7pel__assembly_1__model_1 | I(q)

7pel__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)