8d96

Human DNA polymerase alpha/primase elongation complex I bound to primer/template

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA primase large subunit

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 2 DNA 2	DNA polymerase alpha catalytic subunit × 1 （P09884） ;DNA/RNA (5'-GTP)-R(PGPCPGPGPCPAPCPG)-D(PAPCPC)-3') ; × 1 ;DNA (5'-D(APTPAPAPTPGPGPTPCPGPTPGPCPCPGPCPCPAPAPTPAP*A)-3') ; × 1 IRON/SULFUR CLUSTER × 1 MAGNESIUM ION × 1 ;2'-DEOXYADENOSINE 5'-TRIPHOSPHATE ; × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PRI2_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain B； PDBConstruct 1–509； UniProt 1–509

DNA polymerase alpha catalytic subunit

Homo sapiens

UniProt P09884

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 2 DNA 2	DNA primase large subunit × 1 （P49643） ;DNA/RNA (5'-GTP)-R(PGPCPGPGPCPAPCPG)-D(PAPCPC)-3') ; × 1 ;DNA (5'-D(APTPAPAPTPGPGPTPCPGPTPGPCPCPGPCPCPAPAPTPAP*A)-3') ; × 1 IRON/SULFUR CLUSTER × 1 MAGNESIUM ION × 1 ;2'-DEOXYADENOSINE 5'-TRIPHOSPHATE ; × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DPOLA_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 1–1462； UniProt 1–1462

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8d96
Deposition date deposition_date	2022-06-09
Structure title title	Human DNA polymerase alpha/primase elongation complex I bound to primer/template
Keywords keywords	DNA replication, human DNA polymerase alpha/primase, human primosome, elongation complex, REPLICATION; REPLICATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8d96__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8d96__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8d96__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.81 Å
Rg (electron density)	38.00 Å
Total Rg	38.36 Å
Atom count	9203
Residues	1086
Excluded volume	163160 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8d96__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	DNA primase large subunit
Molecular weight formula_weight	58890.9 kDa
EC 编号 ec_number	2.7.7.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B
Atom count atom_count	9203

MEFSGRKWRKLRLAGDQRNASYPHCLQFYLQPPSENISLIEFENLAIDRVKLLKSVENLGVSYVKGTEQYQSKLESELRKLKFSYRENLEDEYEPRRRDHISHFILRLAYCQSEELRRWFIQQEMDLLRFRFSILPKDKIQDFLKDSQLQFEAISDEEKTLREQEIVASSPSLSGLKLGFESIYKIPFADALDLFRGRKVYLEDGFAYVPLKDIVAIILNEFRAKLSKALALTARSLPAVQSDERLQPLLNHLSHSYTGQDYSTQGNVGKISLDQIDLLSTKSFPPCMRQLHKALRENHHLRHGGRMQYGLFLKGIGLTLEQALQFWKQEFIKGKMDPDKFDKGYSYNIRHSFGKEGKRTDYTPFSCLKIILSNPPSQGDYHGCPFRHSDPELLKQKLQSYKISPGGISQILDLVKGTHYQVACQKYFEMIHNVDDCGFSLNHPNQFFCESQRILNGGKDIKKEPIQPETPQPKPSVQKTKDASSALASLNSSLEMDMEGLEDYFSEDS

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

Entity 2 Entity 2 polymer

Description description	DNA polymerase alpha catalytic subunit
Molecular weight formula_weight	166131.1 kDa
EC 编号 ec_number	2.7.7.7
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MAPVHGDDSLSDSGSFVSSRARREKKSKKGRQEALERLKKAKAGEKYKYEVEDFTGVYEEVDEEQYSKLVQARQDDDWIVDDDGIGYVEDGREIFDDDLEDDALDADEKGKDGKARNKDKRNVKKLAVTKPNNIKSMFIACAGKKTADKAVDLSKDGLLGDILQDLNTETPQITPPPVMILKKKRSIGASPNPFSVHTATAVPSGKIASPVSRKEPPLTPVPLKRAEFAGDDVQVESTEEEQESGAMEFEDGDFDEPMEVEEVDLEPMAAKAWDKESEPAEEVKQEADSGKGTVSYLGSFLPDVSCWDIDQEGDSSFSVQEVQVDSSHLPLVKGADEEQVFHFYWLDAYEDQYNQPGVVFLFGKVWIESAETHVSCCVMVKNIERTLYFLPREMKIDLNTGKETGTPISMKDVYEEFDEKIATKYKIMKFKSKPVEKNYAFEIPDVPEKSEYLEVKYSAEMPQLPQDLKGETFSHVFGTNTSSLELFLMNRKIKGPCWLEVKSPQLLNQPVSWCKVEAMALKPDLVNVIKDVSPPPLVVMAFSMKTMQNAKNHQNEIIAMAALVHHSFALDKAAPKPPFQSHFCVVSKPKDCIFPYAFKEVIEKKNVKVEVAATERTLLGFFLAKVHKIDPDIIVGHNIYGFELEVLLQRINVCKAPHWSKIGRLKRSNMPKLGGRSGFGERNATCGRMICDVEISAKELIRCKSYHLSELVQQILKTERVVIPMENIQNMYSESSQLLYLLEHTWKDAKFILQIMCELNVLPLALQITNIAGNIMSRTLMGGRSERNEFLLLHAFYENNYIVPDKQIFRKPQQKLGDEDEEIDGDTNKYKKGRKKAAYAGGLVLDPKVGFYDKFILLLDFNSLYPSIIQEFNICFTTVQRVASEAQKVTEDGEQEQIPELPDPSLEMGILPREIRKLVERRKQVKQLMKQQDLNPDLILQYDIRQKALKLTANSMYGCLGFSYSRFYAKPLAALVTYKGREILMHTKEMVQKMNLEVIYGDTDSIMINTNSTNLEEVFKLGNKVKSEVNKLYKLLEIDIDGVFKSLLLLKKKKYAALVVEPTSDGNYVTKQELKGLDIVRRDWCDLAKDTGNFVIGQILSDQSRDTIVENIQKRLIEIGENVLNGSVPVSQFEINKALTKDPQDYPDKKSLPHVHVALWINSQGGRKVKAGDTVSYVICQDGSNLTASQRAYAPEQLQKQDNLTIDTQYYLAQQIHPVVARICEPIDGIDAVLIATWLGLDPTQFRVHHYHKDEENDALLGGPAQLTDEEKYRDCERFKCPCPTCGTENIYDNVFDGSGTDMEPSLYRCSNIDCKASPLTFTVQLSNKLIMDIRRFIKKYYDGWLICEEPTCRNRTRHLPLQFSRTGPLCPACMKATLQPEYSDKSLYTQLCFYRYIFDAECALEKLTTDHEKDKLKKQFFTPKVLQDYRKLKNTAEQFLSRSGYSEVNLSKLFAGCAVKS

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

Entity 3 Entity 3 polymer

Description description	;DNA/RNA (5'-GTP)-R(PGPCPGPGPCPAPCPG)-D(PAPCP*C)-3') ;
Molecular weight formula_weight	3977.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide/polyribonucleotide hybrid
Chain IDs strand_id	E

GGCGGCACGACC

Entity 4 Entity 4 polymer

Description description	;DNA (5'-D(APTPAPAPTPGPGPTPCPGPTPGPCPCPGPCPCPAPAPTPAPA)-3') ;
Molecular weight formula_weight	6760.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

ATAATGGTCGTGCCGCCAATAA

Entity 5 Entity 5 non-polymer

Description description	IRON/SULFUR CLUSTER
Molecular weight formula_weight	351.6 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 non-polymer

Description description	;2'-DEOXYADENOSINE 5'-TRIPHOSPHATE ;
Molecular weight formula_weight	491.2 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.35 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	151102

Human DNA polymerase alpha/primase elongation complex I bound to primer/template

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA primase large subunit

State in the Current Structure

Other States of the Same Protein in the Database

DNA polymerase alpha catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8d96__assembly_1__model_1

8d96__assembly_1__model_1 | I(q)

8d96__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

7. Citations (1)

Human DNA polymerase alpha/primase elongation complex I bound to primer/template

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA primase large subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA polymerase alpha catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8d96__assembly_1__model_1

8d96__assembly_1__model_1 | I(q)

8d96__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

7. Citations (1)