8hkc

Cryo-EM structure of E. coli RNAP sigma32 complex

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase subunit alpha

Escherichia coli K-12

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	DNA-directed RNA polymerase subunit beta × 1 （P0A8V2） ;DNA-directed RNA polymerase subunit beta' ; × 1 （P0A8T7） DNA (54-MER) × 1 DNA (54-MER) × 1 RNA polymerase sigma factor RpoH × 1 （P0AGB3） ZINC ION × 2 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPOA_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–329； UniProt 1–329 Author chain B； PDBConstruct 1–329； UniProt 1–329

DNA-directed RNA polymerase subunit beta

Escherichia coli K-12

UniProt P0A8V2

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	DNA-directed RNA polymerase subunit alpha × 2 （P0A7Z4） ;DNA-directed RNA polymerase subunit beta' ; × 1 （P0A8T7） DNA (54-MER) × 1 DNA (54-MER) × 1 RNA polymerase sigma factor RpoH × 1 （P0AGB3） ZINC ION × 2 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPOB_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 4–1344； UniProt 2–1342

;DNA-directed RNA polymerase subunit beta' ;

Escherichia coli K-12

UniProt P0A8T7

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	DNA-directed RNA polymerase subunit alpha × 2 （P0A7Z4） DNA-directed RNA polymerase subunit beta × 1 （P0A8V2） DNA (54-MER) × 1 DNA (54-MER) × 1 RNA polymerase sigma factor RpoH × 1 （P0AGB3） ZINC ION × 2 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPOC_ECOLI
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain F； PDBConstruct 4–1409； UniProt 2–1407

RNA polymerase sigma factor RpoH

Escherichia coli K-12

UniProt P0AGB3

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	DNA-directed RNA polymerase subunit alpha × 2 （P0A7Z4） DNA-directed RNA polymerase subunit beta × 1 （P0A8V2） ;DNA-directed RNA polymerase subunit beta' ; × 1 （P0A8T7） DNA (54-MER) × 1 DNA (54-MER) × 1 ZINC ION × 2 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPOH_ECOLI
Isoform	—
PDB entities	6
Chains and sequence ranges	Author chain E； PDBConstruct 1–284； UniProt 1–284

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8hkc
Deposition date deposition_date	2022-11-25
Structure title title	Cryo-EM structure of E. coli RNAP sigma32 complex
Keywords keywords	transcription, RNA polymerase, sigma factor, heat shock response, TRANSCRIPTION-DNA complex; TRANSCRIPTION/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8hkc__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8hkc__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8hkc__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	49.92 Å
Rg (electron density)	48.70 Å
Total Rg	49.01 Å
Atom count	25779
Residues	3150
Excluded volume	453310 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8hkc__assembly_1__model_1`	heptameric （7）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	DNA-directed RNA polymerase subunit alpha
Molecular weight formula_weight	36801.0 kDa
EC 编号 ec_number	2.7.7.6
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	25779

MQGSVTEFLKPRLVDIEQVSSTHAKVTLEPLERGFGHTLGNALRRILLSSMPGCAVTEVEIDGVLHEYSTKEGVQEDILEILLNLKGLAVRVQGKDEVILTLNKSGIGPVTAADITHDGDVEIVKPQHVICHLTDENASISMRIKVQRGRGYVPASTRIHSEEDERPIGRLLVDACYSPVERIAYNVEAARVEQRTDLDKLVIEMETNGTIDPEEAIRRAATILAEQLEAFVDLRDVRQPEVKEEKPEFDPILLRPVDDLELTVRSANCLKAEAIHYIGDLVQRTEVELLKTPNLGKKSLTEIKDVLASRGLSLGMRLENWPPASIADEKL

Source Source

Source organism organism	Escherichia coli K-12
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA-directed RNA polymerase subunit beta
Molecular weight formula_weight	151341.4 kDa
EC 编号 ec_number	2.7.7.6
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MEFVYSYTEKKRIRKDFGKRPQVLDVPYLLSIQLDSFQKFIEQDPEGQYGLEAAFRSVFPIQSYSGNSELQYVSYRLGEPVFDVQECQIRGVTYSAPLRVKLRLVIYEREAPEGTVKDIKEQEVYMGEIPLMTDNGTFVINGTERVIVSQLHRSPGVFFDSDKGKTHSSGKVLYNARIIPYRGSWLDFEFDPKDNLFVRIDRRRKLPATIILRALNYTTEQILDLFFEKVIFEIRDNKLQMELVPERLRGETASFDIEANGKVYVEKGRRITARHIRQLEKDDVKLIEVPVEYIAGKVVAKDYIDESTGELICAANMELSLDLLAKLSQSGHKRIETLFTNDLDHGPYISETLRVDPTNDRLSALVEIYRMMRPGEPPTREAAESLFENLFFSEDRYDLSAVGRMKFNRSLLREEIEGSGILSKDDIIDVMKKLIDIRNGKGEVDDIDHLGNRRIRSVGEMAENQFRVGLVRVERAVKERLSLGDLDTLMPQDMINAKPISAAVKEFFGSSQLSQFMDQNNPLSEITHKRRISALGPGGLTRERAGFEVRDVHPTHYGRVCPIETPEGPNIGLINSLSVYAQTNEYGFLETPYRKVTDGVVTDEIHYLSAIEEGNYVIAQANSNLDEEGHFVEDLVTCRSKGESSLFSRDQVDYMDVSTQQVVSVGASLIPFLEHDDANRALMGANMQRQAVPTLRADKPLVGTGMERAVAVDSGVTAVAKRGGVVQYVDASRIVIKVNEDEMYPGEAGIDIYNLTKYTRSNQNTCINQMPCVSLGEPVERGDVLADGPSTDLGELALGQNMRVAFMPWNGYNFEDSILVSERVVQEDRFTTIHIQELACVSRDTKLGPEEITADIPNVGEAALSKLDESGIVYIGAEVTGGDILVGKVTPKGETQLTPEEKLLRAIFGEKASDVKDSSLRVPNGVSGTVIDVQVFTRDGVEKDKRALEIEEMQLKQAKKDLSEELQILEAGLFSRIRAVLVAGGVEAEKLDKLPRDRWLELGLTDEEKQNQLEQLAEQYDELKHEFEKKLEAKRRKITQGDDLAPGVLKIVKVYLAVKRRIQPGDKMAGRHGNKGVISKINPIEDMPYDENGTPVDIVLNPLGVPSRMNIGQILETHLGMAAKGIGDKINAMLKQQQEVAKLREFIQRAYDLGADVRQKVDLSTFSDEEVMRLAENLRKGMPIATPVFDGAKEAEIKELLKLGDLPTSGQIRLYDGRTGEQFERPVTVGYMYMLKLNHLVDDKMHARSTGSYSLVTQQPLGGKAQFGGQRFGEMEVWALEAYGAAYTLQEMLTVKSDDVNGRTKMYKNIVDGNHQMEPGMPESFNVLLKEIRSLGINIELEDESR

Source Source

Source organism organism	Escherichia coli K-12
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	;DNA-directed RNA polymerase subunit beta' ;
Molecular weight formula_weight	157613.1 kDa
EC 编号 ec_number	2.7.7.6
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	F

MTSKDLLKFLKAQTKTEEFDAIKIALASPDMIRSWSFGEVKKPETINYRTFKPERDGLFCARIFGPVKDYECLCGKYKRLKHRGVICEKCGVEVTQTKVRRERMGHIELASPTAHIWFLKSLPSRIGLLLDMPLRDIERVLYFESYVVIEGGMTNLERQQILTEEQYLDALEEFGDEFDAKMGAEAIQALLKSMDLEQECEQLREELNETNSETKRKKLTKRIKLLEAFVQSGNKPEWMILTVLPVLPPDLRPLVPLDGGRFATSDLNDLYRRVINRNNRLKRLLDLAAPDIIVRNEKRMLQEAVDALLDNGRRGRAITGSNKRPLKSLADMIKGKQGRFRQNLLGKRVDYSGRSVITVGPYLRLHQCGLPKKMALELFKPFIYGKLELRGLATTIKAAKKMVEREEAVVWDILDEVIREHPVLLNRAPTLHRLGIQAFEPVLIEGKAIQLHPLVCAAYNADFDGDQMAVHVPLTLEAQLEARALMMSTNNILSPANGEPIIVPSQDVVLGLYYMTRDCVNAKGEGMVLTGPKEAERLYRSGLASLHARVKVRITEYEKDANGELVAKTSLKDTTVGRAILWMIVPKGLPYSIVNQALGKKAISKMLNTCYRILGLKPTVIFADQIMYTGFAYAARSGASVGIDDMVIPEKKHEIISEAEAEVAEIQEQFQSGLVTAGERYNKVIDIWAAANDRVSKAMMDNLQTETVINRDGQEEKQVSFNSIYMMADSGARGSAAQIRQLAGMRGLMAKPDGSIIETPITANFREGLNVLQYFISTHGARKGLADTALKTANSGYLTRRLVDVAQDLVVTEDDCGTHEGIMMTPVIEGGDVKEPLRDRVLGRVTAEDVLKPGTADILVPRNTLLHEQWCDLLEENSVDAVKVRSVVSCDTDFGVCAHCYGRDLARGHIINKGEAIGVIAAQSIGEPGTQLTMRTFHIGGAASRAAAESSIQVKNKGSIKLSNVKSVVNSSGKLVITSRNTELKLIDEFGRTKESYKVPYGAVLAKGDGEQVAGGETVANWDPHTMPVITEVSGFVRFTDMIDGQTITRQTDELTGLSSLVVLDSAERTAGGKDLRPALKIVDAQGNDVLIPGTDMPAQYFLPGKAIVQLEDGVQISSGDTLARIPQESGGTKDITGGLPRVADLFEARRPKEPAILAEISGIVSFGKETKGKRRLVITPVDGSDPYEEMIPKWRQLNVFEGERVERGDVISDGPEAPHDILRLRGVHAVTRYIVNEVQDVYRLQGVKINDKHIEVIVRQMLRKATIVNAGSSDFLEGEQVEYSRVKIANRELEANGKVGATYSRDLLGITKASLATESFISAASFQETTRVLTEAAVAGKRDELRGLKENVIVGRLIPAGTGYAYHQDRMRRRAAGEAPAAPQVTAEDASASLAELLNAGLGGSDNELEHHHHHHHHHHHHGT

Source Source

Source organism organism	Escherichia coli K-12
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	DNA (54-MER)
Molecular weight formula_weight	16614.6 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G

CCCCCTTGAAGACGTGGTTTACGACCCCATTTAGTAGTCAACCGCAGTGAGTGG

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli

Entity 5 Entity 5 polymer

Description description	DNA (54-MER)
Molecular weight formula_weight	16663.7 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H

CCACTCACTGCGGTTGACTACTAAATGGGGTCGTAAACCACGTCTTCAAGGGGG

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli

Entity 6 Entity 6 polymer

Description description	RNA polymerase sigma factor RpoH
Molecular weight formula_weight	32513.8 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	E

MTDKMQSLALAPVGNLDSYIRAANAWPMLSADEERALAEKLHYHGDLEAAKTLILSHLRFVVHIARNYAGYGLPQADLIQEGNIGLMKAVRRFNPEVGVRLVSFAVHWIKAEIHEYVLRNWRIVKVATTKAQRKLFFNLRKTKQRLGWFNQDEVEMVARELGVTSKDVREMESRMAAQDMTFDLSSDDDSDSQPMAPVLYLQDKSSNFADGIEDDNWEEQAANRLTDAMQGLDERSQDIIRARWLDEDNKSTLQELADRYGVSAERVRQLEKNAMKKLRAAIEA

Source Source

Source organism organism	Escherichia coli K-12
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 7 Entity 7 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 8 Entity 8 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	8hkcA01
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	120 — RNA Polymerase Alpha Subunit; Chain A, domain 2
Homologous superfamily homologous superfamily	12 — DNA-directed RNA polymerase, insert domain

Domain ID domain_id	8hkcB01
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	120 — RNA Polymerase Alpha Subunit; Chain A, domain 2
Homologous superfamily homologous superfamily	12 — DNA-directed RNA polymerase, insert domain

Domain ID domain_id	8hkcE01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	601 — RNA Polymerase Primary Sigma Factor
Homologous superfamily homologous superfamily	10 — RNA Polymerase Primary Sigma Factor

Domain ID domain_id	8hkcF01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	132 — Topoisomerase I; Chain A, domain 4
Homologous superfamily homologous superfamily	30 — RNA polymerase Rpb1 funnel domain

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.49 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	641734

Cryo-EM structure of E. coli RNAP sigma32 complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase subunit alpha

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA-directed RNA polymerase subunit beta

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

;DNA-directed RNA polymerase subunit beta' ;

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

RNA polymerase sigma factor RpoH

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8hkc__assembly_1__model_1

8hkc__assembly_1__model_1 | I(q)

8hkc__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

Entity 6 Entity 6 polymer

Polymer Polymer

Source Source

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)