SAXSdb — 8j62

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Core binding factor beta

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 10 RNA 2	APOBEC3G × 2 Viral infectivity factor × 4 ;RNA (5'-R(CPGPGPUPUPGPAPUPUPGPUPUPUPUPAPAPCPAP*A)-3') ; × 2 ZINC ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PEBB_HUMAN
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain D； PDBConstruct 1–156； UniProt 1–156 Author chain F； PDBConstruct 1–156； UniProt 1–156 Author chain H； PDBConstruct 1–156； UniProt 1–156 Author chain J； PDBConstruct 1–156； UniProt 1–156

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8j62
Deposition date deposition_date	2023-04-24
Structure title title	Cryo-EM structure of APOBEC3G-Vif complex
Keywords keywords	Human antiviral protein, HIV, ANTIVIRAL PROTEIN; ANTIVIRAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8j62__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8j62__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8j62__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	34.21 Å
Rg (electron density)	34.25 Å
Total Rg	34.68 Å
Atom count	10448
Residues	1220
Excluded volume	182190 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8j62__assembly_1__model_1`	dodecameric （12）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	APOBEC3G
Molecular weight formula_weight	43857.3 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	10448

GPGHMDPDTFSYNFNNRPILSRRNTVWLCYEVERLDNGTWVKMDQHRGQVYSELKYHPEMRFLSLVSKWKLHRDQEYEVTWYISWSPCTKCARDMATFLQENTHVTLTIFVARLYYFWDPDYQEALRSLAQAGATIKIMNYDEFQHCWSKFVYSQGAPFQPWDGLDEYSQALSGMLGEILRHSMDPPTFTFNFNNEPWVRGRHETYLCYEVERMHNDTWVKLNQRRGFLANQAPHKHGFLEGRHAELCFLDVIPFWKLDLDQDYRVTCFTSWSPCFSCAQEMAKFISKNKHVSLCIKTARIYDDQGRAQEGLRTLAEAGAKISIMTYSEFKHCWDTFVDHQGAPFQPWDGLDEHSQDLSGRLRAILQNQEN

Source Source

Source organism organism	Homo sapiens
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Viral infectivity factor
Molecular weight formula_weight	18180.6 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,E,G,I

MGHHHHHHSQDPMENRWQVMIVWQVDRMRINTWKRLVKHHMYISRKAKDWFYRHHYESTNPKISSEVHIPLGDAKLVITTYWGLHTGERDWHLGQGVSIEWRKKRYSTQVDPDLADQLIHLHYFDEASEGSQIKPPLPSVRKLTEDRWNK

Source Source

Source organism organism	Human immunodeficiency virus 1
NCBI taxonomy ID ncbi_taxonomy_id	11676
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	Core binding factor beta
Molecular weight formula_weight	18528.7 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	D,F,H,J

MPRVVPDQRSKFENEEFFRKLSRECEIKYTGFRDRPHEERQARFQNACRDGRSEIAFVATGTNLSLQFFPASWQGEQRQTPSREYVDLEREAGKVYLKAPMILNGVCVIWKGWIDLQRLDGMGCLEFDEERAQQEDALAQQAFEEARRRTREFEDR

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	;RNA (5'-R(CPGPGPUPUPGPAPUPUPGPUPUPUPUPAPAPCPAP*A)-3') ;
Molecular weight formula_weight	6370.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	X,Y

CGGUUGAUUGUUUUAACAAA

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.50 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	186943

Cryo-EM structure of APOBEC3G-Vif complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Core binding factor beta

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8j62__assembly_1__model_1

8j62__assembly_1__model_1 | I(q)

8j62__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)

Cryo-EM structure of APOBEC3G-Vif complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Core binding factor beta

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8j62__assembly_1__model_1

8j62__assembly_1__model_1 | I(q)

8j62__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)