SAXSdb — 8jg9

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cas9

Staphylococcus aureus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 4 DNA 2 RNA 2	sgRNA × 2 AcrIIA15 × 2 DNA (25-MER) × 1 DNA (25-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	CAS9_STAAU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–1053； UniProt 1–1053 Author chain D； PDBConstruct 1–1053； UniProt 1–1053

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8jg9
Deposition date deposition_date	2023-05-20
Structure title title	Cryo-EM structure of the SaCas9-sgRNA-AcrIIA15-promoter DNA dimer
Keywords keywords	II-A type anti-CRISPR protein, VIRAL PROTEIN; VIRAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8jg9__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8jg9__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8jg9__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	52.84 Å
Rg (electron density)	51.54 Å
Total Rg	51.87 Å
Atom count	24264
Residues	2646
Excluded volume	415500 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8jg9__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	CRISPR-associated endonuclease Cas9
Molecular weight formula_weight	124158.7 kDa
EC 编号 ec_number	3.1.-.-
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,D
Atom count atom_count	24264

MKRNYILGLDIGITSVGYGIIDYETRDVIDAGVRLFKEANVENNEGRRSKRGARRLKRRRRHRIQRVKKLLFDYNLLTDHSELSGINPYEARVKGLSQKLSEEEFSAALLHLAKRRGVHNVNEVEEDTGNELSTKEQISRNSKALEEKYVAELQLERLKKDGEVRGSINRFKTSDYVKEAKQLLKVQKAYHQLDQSFIDTYIDLLETRRTYYEGPGEGSPFGWKDIKEWYEMLMGHCTYFPEELRSVKYAYNADLYNALNDLNNLVITRDENEKLEYYEKFQIIENVFKQKKKPTLKQIAKEILVNEEDIKGYRVTSTGKPEFTNLKVYHDIKDITARKEIIENAELLDQIAKILTIYQSSEDIQEELTNLNSELTQEEIEQISNLKGYTGTHNLSLKAINLILDELWHTNDNQIAIFNRLKLVPKKVDLSQQKEIPTTLVDDFILSPVVKRSFIQSIKVINAIIKKYGLPNDIIIELAREKNSKDAQKMINEMQKRNRQTNERIEEIIRTTGKENAKYLIEKIKLHDMQEGKCLYSLEAIPLEDLLNNPFNYEVDHIIPRSVSFDNSFNNKVLVKQEENSKKGNRTPFQYLSSSDSKISYETFKKHILNLAKGKGRISKTKKEYLLEERDINRFSVQKDFINRNLVDTRYATRGLMNLLRSYFRVNNLDVKVKSINGGFTSFLRRKWKFKKERNKGYKHHAEDALIIANADFIFKEWKKLDKAKKVMENQMFEEKQAESMPEIETEQEYKEIFITPHQIKHIKDFKDYKYSHRVDKKPNRELINDTLYSTRKDDKGNTLIVNNLNGLYDKDNDKLKKLINKSPEKLLMYHHDPQTYQKLKLIMEQYGDEKNPLYKYYEETGNYLTKYSKKDNGPVIKKIKYYGNKLNAHLDITDDYPNSRNKVVKLSLKPYRFDVYLDNGVYKFVTVKNLDVIKKENYYEVNSKCYEEAKKLKKISNQAEFIASFYNNDLIKINGELYRVIGVNNDLLNRIEVNMIDITYREYLENMNDKRPPRIIKTIASKTQSIKKYSTDILGNLYEVKSKKHPQIIKKG

Source Source

Source organism organism	Staphylococcus aureus
NCBI taxonomy ID ncbi_taxonomy_id	1280
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	sgRNA
Molecular weight formula_weight	31304.4 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,E

GGUCUGCUAUUUCUAUUUACGUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUC

Source Source

Source organism organism	Staphylococcus aureus
NCBI taxonomy ID ncbi_taxonomy_id	1280
Host organism host_organism	Escherichia coli DH5[alpha]

Entity 3 Entity 3 polymer

Description description	AcrIIA15
Molecular weight formula_weight	20161.0 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	F,C

SMRKTIERLLNSELSSNSIAVRTGVSQAVISKLRNGKKELGNLTLNSAEKLFEYQKEMEKVDTWIVYRGRTADMNKSYIAEGSTYEEVYNNFVDKYGYDVLDEDIYEIQLLKKNGENLDDYDVDSDGINNYDKLDEFRESDYVDLEDYDYRELFENSSSQVYYHEFEITHE

Source Source

Source organism organism	Staphylococcus delphini
NCBI taxonomy ID ncbi_taxonomy_id	53344
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 4 Entity 4 polymer

Description description	DNA (25-MER)
Molecular weight formula_weight	7722.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G

ATAATTATGACAAATGTCATAGAAA

Entity 5 Entity 5 polymer

Description description	DNA (25-MER)
Molecular weight formula_weight	7628.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H

TTTTCTATGACATTTGTCATAATTA

▶

Resolution resolution	3.82 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	72182

Cryo-EM structure of the SaCas9-sgRNA-AcrIIA15-promoter DNA dimer

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cas9

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8jg9__assembly_1__model_1

8jg9__assembly_1__model_1 | I(q)

8jg9__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

7. Citations (1)

Cryo-EM structure of the SaCas9-sgRNA-AcrIIA15-promoter DNA dimer

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cas9

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8jg9__assembly_1__model_1

8jg9__assembly_1__model_1 | I(q)

8jg9__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

7. Citations (1)