9d5k

Human Adenosine Deaminase Acting on dsRNA (ADAR2-RD) bound to dsRNA containing an expanded cytidine analog at the -1 position of the guide strand

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Isoform 4 of Double-stranded RNA-specific editase 1

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Homooligomer	Protein 2 DNA 1 RNA 1	RNA Top Strand × 1 RNA Bottom Strand × 1 INOSITOL HEXAKISPHOSPHATE × 2 ZINC ION × 2 MAGNESIUM ION × 1 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RED1_HUMAN
Isoform	P78563-4
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–487； UniProt 243–729 Author chain B； PDBConstruct 1–487； UniProt 243–729

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9d5k
Deposition date deposition_date	2024-08-13
Last revision last_revision	2024-11-06
Structure title title	Human Adenosine Deaminase Acting on dsRNA (ADAR2-RD) bound to dsRNA containing an expanded cytidine analog at the -1 position of the guide strand
Keywords keywords	Adenosine Deaminase, dsRNA, Complex, RNA editing, cytidine analog, RNA BINDING PROTEIN, RNA BINDING PROTEIN-RNA complex; RNA BINDING PROTEIN/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9d5k__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9d5k__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9d5k__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	32.67 Å
Rg (electron density)	32.04 Å
Total Rg	32.52 Å
Atom count	7911
Residues	888
Excluded volume	135600 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9d5k__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	Isoform 4 of Double-stranded RNA-specific editase 1
Molecular weight formula_weight	53932.7 kDa
EC 编号 ec_number	3.5.4.37
Mutation mutation	E488Q
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	7953

ASLAQPPLPVLPPFPPPSGKNPVMILNELRPGLKYDFLSESGESHAKSFVMSVVVDGQFFEGSGRNKKLAKARAAQSALAAIFNLHLDQTPSRQPIPSEGLQLHLPQVLADAVSRLVLGKFGDLTDNFSSPHARRKVLAGVVMTTGTDVKDAKVISVSTGTKCINGEYMSDRGLALNDCHAEIISRRSLLRFLYTQLELYLNNKDDQKRSIFQKSERGGFRLKENVQFHLYISTSPCGDARIFSPHEPILEEPADRHPNRKARGQLRTKIESGQGTIPVRSNASIQTWDGVLQGERLLTMSCSDKIARWNVVGIQGSLLSIFVEPIYFSSIILGSLYHGDHLSRAMYQRISNIEDLPPLYTLNKPLLSGISNAEARQPGKAPNFSVNWTVGDSAIEVINATTGKDELGRASRLCKHALYCRWMRVHGKVPSHLLRSKITKPNVYHESKLAAKEYQAAKARLFTAFIKAGLGAWVEKPTEQDQFSLTP

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Saccharomyces cerevisiae

Entity 2 Entity 2 polymer

Description description	RNA Top Strand
Molecular weight formula_weight	10355.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C

GCUCGCGAUGCGXGAGGGCUCUGAUAGCUACG

Entity 3 Entity 3 polymer

Description description	RNA Bottom Strand
Molecular weight formula_weight	10237.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide/polyribonucleotide hybrid
Chain IDs strand_id	D

CGUAGCUAUCAGAGCCCCCCXGCAUCGCGAGC

Entity 4 Entity 4 non-polymer

Description description	INOSITOL HEXAKISPHOSPHATE
Molecular weight formula_weight	660.0 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	34

▶

Unit-cell length a length_a	174.775 Å
Unit-cell length b length_b	63.112 Å
Unit-cell length c length_c	141.064 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	118.54 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	monoclinic

Resolution resolution	2.697 Å
Low-resolution limit resolution_low	49.460 Å
R factor r_factor	0.2234
R_work r_work	0.2209
R_free r_free	0.2683

Human Adenosine Deaminase Acting on dsRNA (ADAR2-RD) bound to dsRNA containing an expanded cytidine analog at the -1 position of the guide strand

1. Protein Identity and Related Structures Protein Identity & Related Structures

Isoform 4 of Double-stranded RNA-specific editase 1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9d5k__assembly_1__model_1

9d5k__assembly_1__model_1 | I(q)

9d5k__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

7. Citations (1)

Human Adenosine Deaminase Acting on dsRNA (ADAR2-RD) bound to dsRNA containing an expanded cytidine analog at the -1 position of the guide strand

1. Protein Identity and Related Structures Protein Identity & Related Structures

Isoform 4 of Double-stranded RNA-specific editase 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9d5k__assembly_1__model_1

9d5k__assembly_1__model_1 | I(q)

9d5k__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

7. Citations (1)