SAXSdb — 9ewz

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Adenine-specific methyltransferase BrxX

Escherichia coli

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain C； UniProt 1–1205	Not recorded	DNA (26-MER) with BREX binding site GGTAAG × 1 DNA (26-MER) with BREX binding site GGTAAG × 1 MG MAGNESIUM ION × 1 SAM S-ADENOSYLMETHIONINE × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 2.22 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9EWZ	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
9EX7 Cryo-EM structure of the E. coli BrxX methyltransferase in complex with Ocr Deposited 2024-04-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain A 1–1205（1205 aa） Chain B 1–1205（1205 aa）	Not recorded	MG MAGNESIUM ION × 2 SAM S-ADENOSYLMETHIONINE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.91 Å
9EXH Cryo-EM structure of the Apo E. coli BrxX methyltransferase Deposited 2024-04-08	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–1205（1205 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å

2 other PDB entries and 2 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	PGLX_ECOHS
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain C； PDBConstruct 1–1205； UniProt 1–1205

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9ewz
Deposition date deposition_date	2024-04-05
Structure title title	Cryo-EM structure of the E. coli BrxX methyltransferase in complex with DNA
Keywords keywords	Methyltransferase, phage defense, BREX, TRANSFERASE; TRANSFERASE
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	37.50 Å
Radius of gyration Rg (electron density) rg_electron	37.28 Å
Forward intensity I(0) i0	404284000.00
Molecular weight molecular_weight	153840.0 kDa
Excluded volume excluded_volume	188280 Å³
Envelope volume envelope_volume	256380 Å³
Hydration-shell volume shell_volume	56150 Å³
Envelope diameter envelope_diameter	126.1 Å
Shell Rg shell_rg	44.36 Å
Envelope Rg envelope_rg	36.89 Å
Shape Rg shape_rg	37.30 Å
Total Rg total_rg	37.63 Å
Total atoms total_atoms	10780
Residues n_residues	1255
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	119.9 Å
Rg (real space) rg_real	37.41 Å
Rg uncertainty (real space) rg_real_error	1.20 Å
I(0) (real space) i0_real	4.0430e+08
I(0) uncertainty (real space) i0_real_error	6.3900e+06
Rg (reciprocal space) rg_reciprocal	37.47 Å
I(0) (reciprocal space) i0_reciprocal	404300000.0000
Solution quality estimate total_estimate	0.8972
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	42.8 Å
Skewness Skewness skewness	0.264
Kurtosis Kurtosis kurtosis	-0.491
Angular range angular_range	— – 0.2100 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	64250000.0000
Real-space data points n_real_points	43
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.922; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.997; Smooth: 0.897

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Adenine-specific methyltransferase BrxX
Molecular weight formula_weight	138128.3 kDa
EC 编号 ec_number	2.1.1.72
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C
Atom count atom_count	10780

MNTNNIKKYAPQARNDFRDAVIQKLTTLGIAADKKGNLQIAEAETIGETVRYGQFDYPLSTLPRRERLVKRAREQGFEVLVEHCAYTWFNRLCAIRYMELHGYLDHGFRMLSHPETPTAFEVLDHVPEVAEALLPESKAQLVEMKLSGNQDEALYRELLLGQCHALHHAMPFLFEAVDDEAELLLPDNLTRTDSILRGLVDDIPEEDWEQVEVIGWLYQFYISEKKDAVIGKVVKSEDIPAATQLFTPNWIVQYLVQNSVGRQWLQTYPDSPLKDKMEYYIEPAEQTPEVQAQLAAITPASIEPESIKVLDPACGSGHILTEAYNVLKAIYEERGYRTRDIPQLILENNIFGLDIDDRAAQLSGFAMLMLARQDDRRILGRGVRLNIVSLQESKLDIAEVWTKLNFHQHMQRGSMGDMFTQGTALANTDSAEYKLLMRTLALFTSAKTLGSLIQVPQEDEAALKAFLERLYRLAVEGDIQQKEAAAELIPYIQQAWILAQRYDAVVANPPYMGGKGMNGDLKEFAKKQFPDSKSDLFAMFMQHAFSLLKENGFNAQVNMQSWMFLSSYEALRGWLLDNKTFITMAHLGARAFGQISGEVVQTTAWVIKNNHSGFYKPVFFRLVDDNEEHKKNNLLNRMNCFKNTLQNDFKKIPGSPIAYWATLAFINSFLKLPALGTRAVKGLDTNGSIDVFLRRWPEVSINSFDALGKGNSKWFPIAKGGELRKWFGNHEYIINYENDGIELRKNKANLRNKDMYFQEGGTWTVVSTTGFSMRYMPKGFLFDQGGSAVFCENNDELSIYNILACMNSKYINYSASLICPTLNFTTGDVRKFPVIKNNHLEDLAKKAIEISKADWNQFETSWEFSKNKLIEHKGNVAYSYASYCNFQDKLYEQLVNIEKNINNIIEEILGFKIETTENSELITLNSNKIYRYGQSETNDTFLNRHRSDTISELISYSVGCQMGRYSLDREGLVYAHEGNKGFAELAAEGAYKTFPADNDGILPLMDDEWFEDDVTSRVKEFVRTVWGEEHLQENLEFIAESLCLYAIKPKKGESALETIRRYLSTQFWKDHMKMYKKRPIYWLFSSGKEKAFECLVYLHRYNDATLSRMRTEYVVPLLARYQANIDRLNDQLDEASGGEATRLKRERDSLIKKFSELRSYDDRLRHYADMRISIDLDDGVKVNYGKFGDLLADVKAITGNAPEAI

来源 Source

来源生物 organism	Escherichia coli
NCBI Class编号 ncbi_taxonomy_id	562
宿主生物 host_organism	Escherichia coli B

Entity 2 Entity 2 polymer

Description description	DNA (26-MER) with BREX binding site GGTAAG
Molecular weight formula_weight	7803.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

TCAGTGGTAAGGTCAGGAATGAGTC

Entity 3 Entity 3 polymer

Description description	DNA (26-MER) with BREX binding site GGTAAG
Molecular weight formula_weight	7553.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	A

GACTCATTCCTGACCTTACCACTGA

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	S-ADENOSYLMETHIONINE
Molecular weight formula_weight	398.4 kDa
Source method src_method	syn
Copy count entity_count	1

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.22 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	216233

fit	/app/data/saxs_computation/ew/9ewz/9ewz.fit
pddf	/app/data/pr_computation/ew/9ewz/9ewz.pr.out
profile	/app/data/saxs_computation/ew/9ewz/9ewz.dat

Cryo-EM structure of the E. coli BrxX methyltransferase in complex with DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Adenine-specific methyltransferase BrxX

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)