SAXSdb — 9go0

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cas12k

Scytonema hofmannii

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Other combination Monomer Protein × 1 DNA 2 RNA 1 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 1–639	Not recorded	sgRNA × 1 DNA target strand × 1 DNA non-target strand × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5；20 mM HEPES-KOH pH 7.5, 50 mM KCl, 10 mM MgCl2, 1 mM DTT cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.04 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9GO0	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
8AXA Cryo-EM structure of shCas12k-sgRNA-dsDNA ternary complex (type V-K CRISPR-associated transposon) Deposited 2022-08-31	Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–639（639 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；3 s blotting, 4 degrees celcius	Resolution 2.96 Å
8AXB Cryo-EM structure of Cas12k-sgRNA binary complex (type V-K CRISPR-associated transposon) Deposited 2022-08-31	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–639（639 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；3 s blotting, 4 degrees celcius	Resolution 2.87 Å
8BD6 Cas12k-sgRNA-dsDNA-TnsC non-productive complex. Deposited 2022-10-18	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 10 PDB declaration: pentadecameric	Chain A 2–639（638 aa）	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 9 MG MAGNESIUM ION × 9	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.10 Å
8EA3 V-K CAST Transpososome from Scytonema hofmanni, major configuration Deposited 2022-08-27	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 23 PDB declaration: 30-meric	Chain O 1–639（639 aa）	Not recorded	MG MAGNESIUM ION × 14 ATP ADENOSINE-5'-TRIPHOSPHATE × 12	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.70 Å
8EA4 V-K CAST Transpososome from Scytonema hofmanni, minor configuration Deposited 2022-08-27	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 24 PDB declaration: 31-meric	Chain O 1–639（639 aa）	Not recorded	MG MAGNESIUM ION × 15 ATP ADENOSINE-5'-TRIPHOSPHATE × 13	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å

5 other PDB entries and 5 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	A0A8M0FGU0_9CYAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 3–641； UniProt 1–639

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9go0
Deposition date deposition_date	2024-09-04
最后修订 last_revision	2025-09-17
Structure title title	Cryo-EM structure of ShCas12k in complex with a sgRNA and a dsDNA target
Keywords keywords	Cas12k, sgRNA, target DNA, Protein-RNA-DNA complex, Tn7, DNA Binding Protein, Transposition, CRISPR; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	34.93 Å
Radius of gyration Rg (electron density) rg_electron	33.95 Å
Forward intensity I(0) i0	572845000.00
Molecular weight molecular_weight	133180.0 kDa
Excluded volume excluded_volume	140760 Å³
Envelope volume envelope_volume	211450 Å³
Hydration-shell volume shell_volume	51468 Å³
Envelope diameter envelope_diameter	113.2 Å
Shell Rg shell_rg	40.96 Å
Envelope Rg envelope_rg	33.36 Å
Shape Rg shape_rg	33.86 Å
Total Rg total_rg	34.48 Å
Total atoms total_atoms	9014
Residues n_residues	696
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	109.5 Å
Rg (real space) rg_real	34.78 Å
Rg uncertainty (real space) rg_real_error	0.62 Å
I(0) (real space) i0_real	5.7280e+08
I(0) uncertainty (real space) i0_real_error	9.0140e+06
Rg (reciprocal space) rg_reciprocal	34.88 Å
I(0) (reciprocal space) i0_reciprocal	572900000.0000
Solution quality estimate total_estimate	0.9001
Solution quality rating solution_quality	EXCELLENT a EXCELLENT solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	43.8 Å
Skewness Skewness skewness	0.178
Kurtosis Kurtosis kurtosis	-0.473
Angular range angular_range	— – 0.2250 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	24350000.0000
Real-space data points n_real_points	46
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.933; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.987; Smooth: 0.910

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Cas12k
Molecular weight formula_weight	73421.8 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	9014

SNASQITIQARLISFESNRQQLWKLMADLNTPLINELLCQLGQHPDFEKWQQKGKLPSTVVSQLCQPLKTDPRFAGQPSRLYMSAIHIVDYIYKSWLAIQKRLQQQLDGKTRWLEMLNSDAELVELSGDTLEAIRVKAAEILAIAMPASESDSASPKGKKGKKEKKPSSSSPKRSLSKTLFDAYQETEDIKSRSAISYLLKNGCKLTDKEEDSEKFAKRRRQVEIQIQRLTEKLISRMPKGRDLTNAKWLETLLTATTTVAEDNAQAKRWQDILLTRSSSLPFPLVFETNEDMVWSKNQKGRLCVHFNGLSDLIFEVYCGNRQLHWFQRFLEDQQTKRKSKNQHSSGLFTLRNGHLVWLEGEGKGEPWNLHHLTLYCCVDNRLWTEEGTEIVRQEKADEITKFITNMKKKSDLSDTQQALIQRKQSTLTRINNSFERPSQPLYQGQSHILVGVSLGLEKPATVAVVDAIANKVLAYRSIKQLLGDNYELLNRQRRQQQYLSHERHKAQKNFSPNQFGASELGQHIDRLLAKAIVALARTYKAGSIVLPKLGDMREVVQSEIQAIAEQKFPGYIEGQQKYAKQYRVNVHRWSYGRLIQSIQSKAAQTGIVIEEGKQPIRGSPHDKAKELALSAYNLRLTRRS

来源 Source

来源生物 organism	Scytonema hofmannii
NCBI Class编号 ncbi_taxonomy_id	34078
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	sgRNA
Molecular weight formula_weight	82376.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GGAUAUUAAUAGCGCCGCAAUUCAUGCUGCUUGCAGCCUCUGAAUUUUGUUAAAUGAGGGUUAGUUUGACUGUAUAAAUACAGUCUUGCUUUCUGACCCUGGUAGCUGCUCACCCUGAUGCUGCUGUCAAUAGACAGGAUAGGUGCGCUCCCAGCAAUAAGGGCGCGGAUGUACUGCUGUAGUGGCUACUGAAUCACCCCCGAUCAAGGGGGAACCCUAAAUGGGUUGAAAGGAGAAGUCAUUUAAUAAGGCCACU

Entity 3 Entity 3 polymer

Description description	DNA target strand
Molecular weight formula_weight	15301.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GTTTAACAGTGGCCTTATTAAATGACTTCTCAACCTCCTACGTATCGTAG

Entity 4 Entity 4 polymer

Description description	DNA non-target strand
Molecular weight formula_weight	15498.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CTACGATACGTAGGAGGTTGAGAAGTCATTTAATAAGGCCACTGTTAAAC

▶

8. Citations (1)

▶

Resolution resolution	3.04 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	138000

fit	/app/data/saxs_computation/go/9go0/9go0.fit
pddf	/app/data/pr_computation/go/9go0/9go0.pr.out
profile	/app/data/saxs_computation/go/9go0/9go0.dat

Cryo-EM structure of ShCas12k in complex with a sgRNA and a dsDNA target

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cas12k

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)