SAXSdb — 9lov

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ATP-dependent RNA helicase DHX58

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Heteromer Protein × 3 RNA 2 PDB declaration: pentameric（5） Consistent with all polymer counts	Chain A； UniProt 1–678	Not recorded	RNA (45-MER) × 1 RNA (45-MER) × 1 Interferon-induced helicase C domain-containing protein 1 × 2 （Q9BYX4） ADP ADENOSINE-5'-DIPHOSPHATE × 3 ZN ZINC ION × 3 MG MAGNESIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.07 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9LOV	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
2RQA Solution structure of LGP2 CTD Deposited 2009-03-17	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 546–678（133 aa） Fragment：UNP residues 546-678	Not recorded	ZN ZINC ION × 1	SOLUTION NMR NMR measurement conditions pH 7；298 K；Ionic strength (raw mmCIF value) 0.25；Pressure ambient NMR sample composition 1mM [U-100% 13C; U-100% 15N] LGP2, 50mM TRIS-2, 250mM sodium chloride-3, 1mM DTT-4, 90% H2O/10% D2O \| 90% H2O/10% D2O	Resolution not provided
2W4R Crystal structure of the regulatory domain of human LGP2 Deposited 2008-12-01	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 537–678（142 aa） Fragment：REGULATORY DOMAIN, RESIDUES 537-678	Not recorded	HG MERCURY (II) ION × 1 SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5	Resolution 2.60 Å R-free 0.266
2W4R Crystal structure of the regulatory domain of human LGP2 Deposited 2008-12-01	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 537–678（142 aa） Fragment：REGULATORY DOMAIN, RESIDUES 537-678	Not recorded	HG MERCURY (II) ION × 1 SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5	Resolution 2.60 Å R-free 0.266
2W4R Crystal structure of the regulatory domain of human LGP2 Deposited 2008-12-01	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 537–678（142 aa） Fragment：REGULATORY DOMAIN, RESIDUES 537-678	Not recorded	HG MERCURY (II) ION × 1 SO4 SULFATE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5	Resolution 2.60 Å R-free 0.266
2W4R Crystal structure of the regulatory domain of human LGP2 Deposited 2008-12-01	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain D 537–678（142 aa） Fragment：REGULATORY DOMAIN, RESIDUES 537-678	Not recorded	HG MERCURY (II) ION × 1 SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5	Resolution 2.60 Å R-free 0.266
3EQT Crystal structure of human LGP2 C-terminal domain in complex with dsRNA Deposited 2008-10-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 541–678（138 aa） Fragment：LGP2 C-terminal domain (UNP residues 541 to 678) Chain B 541–678（138 aa） Fragment：LGP2 C-terminal domain (UNP residues 541 to 678)	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；277 K；0.2 M ammonium sulfate, 16-18% PEG3350, 0.1 M Tris-HCl buffer, protein concentration 30 mg/ml, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.254
9LOU LGP2:dsRNA complex Deposited 2025-01-23	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–678（678 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 ZN ZINC ION × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.36 Å

4 other PDB entries and 7 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DHX58_HUMAN
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–678； UniProt 1–678

Interferon-induced helicase C domain-containing protein 1

Homo sapiens

UniProt Q9BYX4

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Heteromer Protein × 3 RNA 2 PDB declaration: pentameric（5） Consistent with all polymer counts	Chain B； UniProt 287–1025 Chain C； UniProt 287–1025	Not recorded	RNA (45-MER) × 1 RNA (45-MER) × 1 ATP-dependent RNA helicase DHX58 × 1 （Q96C10） ADP ADENOSINE-5'-DIPHOSPHATE × 3 ZN ZINC ION × 3 MG MAGNESIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.07 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9LOV	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
2RQB Solution structure of MDA5 CTD Deposited 2009-03-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 896–1025（130 aa） Fragment：UNP residues 896-1025	Not recorded	ZN ZINC ION × 1	SOLUTION NMR NMR measurement conditions pH 7；298 K；Ionic strength (raw mmCIF value) 0.25；Pressure ambient NMR sample composition 1mM [U-100% 13C; U-100% 15N] MDA5, 20mM Bis-Tris-2, 250mM sodium chloride-3, 10mM DTT-4, 90% H2O/10% D2O \| 90% H2O/10% D2O	Resolution not provided
3B6E Crystal structure of human DECH-box RNA Helicase MDA5 (Melanoma differentiation-associated protein 5), DECH-domain Deposited 2007-10-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 277–490（214 aa） Fragment：DECH domain: Residues 277-490	Not recorded	NA SODIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；1.2M Sodium citrate, 0.1M Tris-HCl, pH 8.0, VAPOR DIFFUSION, SITTING DROP, temperature 298K	Resolution 1.60 Å R-free 0.204
3GA3 Crystal structure of the C-terminal domain of human MDA5 Deposited 2009-02-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 893–1017（125 aa） Fragment：C-terminal domain, residues 893-1017	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions EVAPORATION；pH 8.5；277 K；0.1 M Tris, 14 to 18% ethanol, pH 8.5, EVAPORATION, temperature 277K	Resolution 1.45 Å R-free 0.204
4GL2 Structural Basis for dsRNA duplex backbone recognition by MDA5 Deposited 2012-08-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 306–1017（712 aa）	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 1 ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；293 K；pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 3.56 Å R-free 0.320
4GL2 Structural Basis for dsRNA duplex backbone recognition by MDA5 Deposited 2012-08-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 306–1017（712 aa）	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 1 ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；293 K；pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 3.56 Å R-free 0.320
7DNI MDA5 CARDs-MAVS CARD polyUb complex Deposited 2020-12-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 16 PDB declaration: hexadecameric	Chain A 1–208（208 aa） Chain B 1–208（208 aa） Chain C 1–208（208 aa） Chain D 1–208（208 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5	Resolution 3.20 Å
7DNJ K63-polyUb MDA5CARDs complex Deposited 2020-12-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 12 PDB declaration: dodecameric	Chain A 1–208（208 aa） Chain B 1–208（208 aa） Chain C 1–208（208 aa） Chain D 1–208（208 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen OTHER	Resolution 3.30 Å
7JL0 Cryo-EM structure of MDA5-dsRNA in complex with TRIM65 PSpry domain (Monomer) Deposited 2020-07-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain A 287–1025（739 aa） Fragment：UNP residues 287-1025	Not recorded	ZN ZINC ION × 1 ADP ADENOSINE-5'-DIPHOSPHATE × 1 ALF TETRAFLUOROALUMINATE ION × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.30 Å
7JL2 Cryo-EM structure of MDA5-dsRNA filament in complex with TRIM65 PSpry domain (Trimer) Deposited 2020-07-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 6 PDB declaration: octameric	Chain A 287–1025（739 aa） Fragment：UNP residues 287-1025 Chain C 287–1025（739 aa） Fragment：UNP residues 287-1025 Chain E 287–1025（739 aa） Fragment：UNP residues 287-1025	Not recorded	ZN ZINC ION × 3 ADP ADENOSINE-5'-DIPHOSPHATE × 3 ALF TETRAFLUOROALUMINATE ION × 3 MG MAGNESIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.30 Å

8 other PDB entries and 9 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	IFIH1_HUMAN
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain B； PDBConstruct 1–739； UniProt 287–1025 Author chain C； PDBConstruct 1–739； UniProt 287–1025

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9lov
Deposition date deposition_date	2025-01-23
Structure title title	LGP2:MDA5:dsRNA filament
Keywords keywords	Innate immune system, RNA receptor, Cryo-EM, Filament, IMMUNE SYSTEM, IMMUNE SYSTEM-RNA complex; IMMUNE SYSTEM/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	44.74 Å
Radius of gyration Rg (electron density) rg_electron	45.03 Å
Forward intensity I(0) i0	1149940000.00
Molecular weight molecular_weight	258440.0 kDa
Excluded volume excluded_volume	314660 Å³
Envelope volume envelope_volume	438470 Å³
Hydration-shell volume shell_volume	80912 Å³
Envelope diameter envelope_diameter	155.7 Å
Shell Rg shell_rg	49.64 Å
Envelope Rg envelope_rg	44.35 Å
Shape Rg shape_rg	45.05 Å
Total Rg total_rg	45.16 Å
Total atoms total_atoms	17978
Residues n_residues	2080
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	151.7 Å
Rg (real space) rg_real	44.87 Å
Rg uncertainty (real space) rg_real_error	1.37 Å
I(0) (real space) i0_real	1.1500e+09
I(0) uncertainty (real space) i0_real_error	2.1140e+07
Rg (reciprocal space) rg_reciprocal	44.75 Å
I(0) (reciprocal space) i0_reciprocal	1150000000.0000
Solution quality estimate total_estimate	0.8618
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	47.7 Å
Skewness Skewness skewness	0.440
Kurtosis Kurtosis kurtosis	-0.394
Angular range angular_range	— – 0.1750 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	299400000.0000
Real-space data points n_real_points	36
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.782; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.970; Smooth: 0.882

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	RNA (45-MER)
Molecular weight formula_weight	14278.4 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	Y
Atom count atom_count	17978

UCUCAGUCAGUCAGUCUCAGUCAGUCAGUCUCAGUCAGUCAGUCU

Entity 2 Entity 2 polymer

Description description	RNA (45-MER)
Molecular weight formula_weight	14553.7 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	X

AGACUGACUGACUGAGACUGACUGACUGAGACUGACUGACUGAGA

Entity 3 Entity 3 polymer

Description description	ATP-dependent RNA helicase DHX58
Molecular weight formula_weight	76742.9 kDa
EC 编号 ec_number	3.6.4.13
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MELRSYQWEVIMPALEGKNIIIWLPTGAGKTRAAAYVAKRHLETVDGAKVVVLVNRVHLVTQHGEEFRRMLDGRWTVTTLSGDMGPRAGFGHLARCHDLLICTAELLQMALTSPEEEEHVELTVFSLIVVDECHHTHKDTVYNVIMSQYLELKLQRAQPLPQVLGLTASPGTGGASKLDGAINHVLQLCANLDTWCIMSPQNCCPQLQEHSQQPCKQYNLCHRRSQDPFGDLLKKLMDQIHDHLEMPELSRKFGTQMYEQQVVKLSEAAALAGLQEQRVYALHLRRYNDALLIHDTVRAVDALAALQDFYHREHVTKTQILCAERRLLALFDDRKNELAHLATHGPENPKLEMLEKILQRQFSSSNSPRGIIFTRTRQSAHSLLLWLQQQQGLQTVDIRAQLLIGAGNSSQSTHMTQRDQQEVIRKFQDGTLNLLVATSVAEEGLDIPHCNVVVRYGLLTNEISMVQARGRARADQSVYAFVATEGSRELKRELINEALETLMEQAVAAVQKMDQAEYQAKIRDLQQAALTKRAAQAAQRENQRQQFPVEHVQLLCINCMVAVGHGSDLRKVEGTHHVNVNPNFSNYYNVSRDPVVINKVFKDWKPGGVISCRNCGEVWGLQMIYKSVKLPVLKVRSMLLETPQGRIQAKKWSRVPFSVPDFDFLQHCAENLSDLSLD

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Spodoptera frugiperda

Entity 4 Entity 4 polymer

Description description	Interferon-induced helicase C domain-containing protein 1
Molecular weight formula_weight	84986.8 kDa
EC 编号 ec_number	3.6.4.13
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,C

MGSDSDEENVAARASPEPELQLRPYQMEVAQPALEGKNIIICLPTGSGKTRVAVYIAKDHLDKKKKASEPGKVIVLVNKVLLVEQLFRKEFQPFLKKWYRVIGLSGDTQLKISFPEVVKSCDIIISTAQILENSLLNLENGEDAGVQLSDFSLIIIDECHHTNKEAVYNNIMRHYLMQKLKNNRLKKENKPVIPLPQILGLTASPGVGRATKQAKAEEHILKLCANLDAFTIKTVKENLDQLKNQIQEPCKKFAIADATREDPFKEKLLEIMTRIQTYCQMSPMSDFGTQPYEQWAIQMEKKAAKEGNRKERVCAEHLRKYNEALQINDTIRMIDAYTHLETFYNEEKDKKFAVIEDDSDEGGDDEYCDGDEDEDDLKKPLKLDETDRFLMTLFFENNKMLKRLAENPEYENEKLTKLRNTIMEQYTRTEESARGIIFTKTRQSAYALSQWITENEKFAEVGVKAHHLIGAGHSSEFKPMTQNEQKEVISKFRTGKINLLIATTVAEEGLDIKECNIVIRYGLVTNEIAMVQARGRARADESTYVLVAHSGSGVIERETVNDFREKMMYKAIHCVQNMKPEEYAHKILELQMQSIMEKKMKTKRNIAKHYKNNPSLITFLCKNCSVLACSGEDIHVIEKMHHVNMTPEFKELYIVRENKTLQKKCADYQINGEIICKCGQAWGTMMVHKGLDLPCLKIRNFVVVFKNNSTKKQYKKWVELPITFPNLDYSECCLFSDED

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 5 Entity 5 non-polymer

Description description	ADENOSINE-5'-DIPHOSPHATE
Molecular weight formula_weight	427.2 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 7 Entity 7 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	3

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.070 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	3.07 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	117189

fit	/app/data/saxs_computation/lo/9lov/9lov.fit
pddf	/app/data/pr_computation/lo/9lov/9lov.pr.out
profile	/app/data/saxs_computation/lo/9lov/9lov.dat

LGP2:MDA5:dsRNA filament

1. Protein Identity and Related Structures Protein Identity & Related Structures

ATP-dependent RNA helicase DHX58

State in the Current Structure

Other States of the Same Protein in the Database

Interferon-induced helicase C domain-containing protein 1

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

来源 Source

Entity 4 Entity 4 polymer

Polymer Polymer

来源 Source

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)