9mn7

Structure of the human mitochondrial late-stage transcription initiation complex, IC8

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Dimethyladenosine transferase 2, mitochondrial

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 2 DNA 2 RNA 1	DNA-directed RNA polymerase, mitochondrial × 1 （O00411） Non-Template Strand DNA × 1 RNA × 1 Template Strand DNA × 1 ADENOSINE-5'-TRIPHOSPHATE × 1 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TFB2M_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain B； PDBConstruct 1–396； UniProt 1–396

DNA-directed RNA polymerase, mitochondrial

Homo sapiens

UniProt O00411

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 2 DNA 2 RNA 1	Dimethyladenosine transferase 2, mitochondrial × 1 （Q9H5Q4） Non-Template Strand DNA × 1 RNA × 1 Template Strand DNA × 1 ADENOSINE-5'-TRIPHOSPHATE × 1 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPOM_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain E； PDBConstruct 1–1230； UniProt 1–1230

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9mn7
Deposition date deposition_date	2024-12-20
Structure title title	Structure of the human mitochondrial late-stage transcription initiation complex, IC8
Keywords keywords	Mitochondrial RNA Polymerase, Transcription Initiation complex, TRANSCRIPTION, POLRMT, TRANSCRIPTION-DNA-RNA complex; TRANSCRIPTION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9mn7__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9mn7__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9mn7__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	36.41 Å
Rg (electron density)	36.16 Å
Total Rg	36.65 Å
Atom count	11788
Residues	1364
Excluded volume	206440 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9mn7__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	Dimethyladenosine transferase 2, mitochondrial
Molecular weight formula_weight	45416.8 kDa
EC 编号 ec_number	2.1.1.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B
Atom count atom_count	11788

MWIPVVGLPRRLRLSALAGAGRFCILGSEAATRKHLPARNHCGLSDSSPQLWPEPDFRNPPRKASKASLDFKRYVTDRRLAETLAQIYLGKPSRPPHLLLECNPGPGILTQALLEAGAKVVALESDKTFIPHLESLGKNLDGKLRVIHCDFFKLDPRSGGVIKPPAMSSRGLFKNLGIEAVPWTADIPLKVVGMFPSRGEKRALWKLAYDLYSCTSIYKFGRIEVNMFIGEKEFQKLMADPGNPDLYHVLSVIWQLACEIKVLHMEPWSSFDIYTRKGPLENPKRRELLDQLQQKLYLIQMIPRQNLFTKNLTPMNYNIFFHLLKHCFGRRSATVIDHLRSLTPLDARDILMQIGKQEDEKVVNMHPQDFKTLFETIERSKDCAYKWLYDETLEDR

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA-directed RNA polymerase, mitochondrial
Molecular weight formula_weight	138818.2 kDa
EC 编号 ec_number	2.7.7.6
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	E

MSALCWGRGAAGLKRALRPCGRPGLPGKEGTAGGVCGPRRSSSASPQEQDQDRRKDWGHVELLEVLQARVRQLQAESVSEVVVNRVDVARLPECGSGDGSLQPPRKVQMGAKDATPVPCGRWAKILEKDKRTQQMRMQRLKAKLQMPFQSGEFKALTRRLQVEPRLLSKQMAGCLEDCTRQAPESPWEEQLARLLQEAPGKLSLDVEQAPSGQHSQAQLSGQQQRLLAFFKCCLLTDQLPLAHHLLVVHHGQRQKRKLLTLDMYNAVMLGWARQGAFKELVYVLFMVKDAGLTPDLLSYAAALQCMGRQDQDAGTIERCLEQMSQEGLKLQALFTAVLLSEEDRATVLKAVHKVKPTFSLPPQLPPPVNTSKLLRDVYAKDGRVSYPKLHLPLKTLQCLFEKQLHMELASRVCVVSVEKPTLPSKEVKHARKTLKTLRDQWEKALCRALRETKNRLEREVYEGRFSLYPFLCLLDEREVVRMLLQVLQALPAQGESFTTLARELSARTFSRHVVQRQRVSGQVQALQNHYRKYLCLLASDAEVPEPCLPRQYWEELGAPEALREQPWPLPVQMELGKLLAEMLVQATQMPCSLDKPHRSSRLVPVLYHVYSFRNVQQIGILKPHPAYVQLLEKAAEPTLTFEAVDVPMLCPPLPWTSPHSGAFLLSPTKLMRTVEGATQHQELLETCPPTALHGALDALTQLGNCAWRVNGRVLDLVLQLFQAKGCPQLGVPAPPSEAPQPPEAHLPHSAAPARKAELRRELAHCQKVAREMHSLRAEALYRLSLAQHLRDRVFWLPHNMDFRGRTYPCPPHFNHLGSDVARALLEFAQGRPLGPHGLDWLKIHLVNLTGLKKREPLRKRLAFAEEVMDDILDSADQPLTGRKWWMGAEEPWQTLACCMEVANAVRASDPAAYVSHLPVHQDGSCNGLQHYAALGRDSVGAASVNLEPSDVPQDVYSGVAAQVEVFRRQDAQRGMRVAQVLEGFITRKVVKQTVMTVVYGVTRYGGRLQIEKRLRELSDFPQEFVWEASHYLVRQVFKSLQEMFSGTRAIQHWLTESARLISHMGSVVEWVTPLGVPVIQPYRLDSKVKQIGGGIQSITYTHNGDISRKPNTRKQKNGFPPNFIHSLDSSHMMLTALHCYRKGLTFVSVHDCYWTHAADVSVMNQVCREQFVRLHSEPILQDLSRFLVKRFCSEPQKILEASQLKETLQAVPKPGAFDLEQVKRSTYFFS

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	Non-Template Strand DNA
Molecular weight formula_weight	20524.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	N

GTGTTAGTTAGGGAGTGACTGTTAAAAGTGCATACCGCCAAGAGAAAAGAAAACCCAATTGTGGCC

Entity 4 Entity 4 polymer

Description description	RNA
Molecular weight formula_weight	1962.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R

GAAAAG

Entity 5 Entity 5 polymer

Description description	Template Strand DNA
Molecular weight formula_weight	20162.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T

GGCCACAATTGGGTTTTCTTTTCTCTTGGCGGTATGCACTTTTAACAGTCACTCCCTAACTAACAC

Entity 6 Entity 6 non-polymer

Description description	ADENOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	507.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.650 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	2.65 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	163170

Structure of the human mitochondrial late-stage transcription initiation complex, IC8

1. Protein Identity and Related Structures Protein Identity & Related Structures

Dimethyladenosine transferase 2, mitochondrial

State in the Current Structure

Other States of the Same Protein in the Database

DNA-directed RNA polymerase, mitochondrial

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9mn7__assembly_1__model_1

9mn7__assembly_1__model_1 | I(q)

9mn7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

7. Citations (1)

Structure of the human mitochondrial late-stage transcription initiation complex, IC8

1. Protein Identity and Related Structures Protein Identity & Related Structures

Dimethyladenosine transferase 2, mitochondrial

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA-directed RNA polymerase, mitochondrial

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9mn7__assembly_1__model_1

9mn7__assembly_1__model_1 | I(q)

9mn7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

7. Citations (1)