SAXSdb — 9tep

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Integrase

Lomovskayavirus C31

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 2	attB53_Fw × 1 attB53_Rv × 1 Recombination directionality factor × 2 （Q9T216） ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q9T221_BPPHC
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 21–625； UniProt 1–605 Author chain B； PDBConstruct 21–625； UniProt 1–605

Recombination directionality factor

Lomovskayavirus C31

UniProt Q9T216

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 2	Integrase × 2 （Q9T221） attB53_Fw × 1 attB53_Rv × 1 ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RDF_BPPHC
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain I； PDBConstruct 28–271； UniProt 1–244 Author chain J； PDBConstruct 28–271； UniProt 1–244

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9tep
Deposition date deposition_date	2025-11-25
Structure title title	PhiC31 integraseS12A-attB-RDF complex
Keywords keywords	Serine integrase, Recombinase, Site-specific recombination, RDF, DNA, RECOMBINATION; RECOMBINATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9tep__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9tep__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9tep__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	49.69 Å
Rg (electron density)	49.91 Å
Total Rg	49.85 Å
Atom count	14859
Residues	1724
Excluded volume	255520 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9tep__assembly_1__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Integrase
Molecular weight formula_weight	69566.4 kDa
Mutation mutation	S12A
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	14859

MGSSHHHHHHSSGLVPRGSHMDTYAGAYDRQARERENSSAASPATQRSANEDKAADLQREVERDGGRFRFVGHFSEAPGTSAFGTAERPEFERILNECRAGRLNMIIVYDVSRFSRLKVMDAIPIVSELLALGVTIVSTQEGVFRQGNVMDLIHLIMRLDASHKESSLKSAKILDTKNLQRELGGYVGGKAPYGFELVSETKEITRNGRMVNVVINKLAHSTTPLTGPFEFEPDVIRWWWREIKTHKHLPFKPGSQAAIHPGSITGLCKRMDADAVPTRGETIGKKTASSAWDPATVMRILRDPRIAGFAAEVIYKKKPDGTPTTKIEGYRIQRDPITLRPVELDCGPIIEPAEWYELQAWLDGRGRGKGLSRGQAILSAMDKLYCECGAVMTSKRGEESIKDSYRCRRRKVVDPSAPGQHEGTCNVSMAALDKFVAERIFNKIRHAEGDEETLALLWEAARRFGKLTEAPEKSGERANLVAERADALNALEELYEDRAAGAYDGPVGRKHFRKQQAALTLRQQGAEERLAELEAAEAPKLPLDQWFPEDADADPTGPKSWWGRASVDDKRVFVGLFVDKIVVTKSTTGRGQGTPIEKRASITWAKPPTDDDEDDAQDGTEDVAATS

Source Source

Source organism organism	Lomovskayavirus C31
NCBI taxonomy ID ncbi_taxonomy_id	10719
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	attB53_Fw
Molecular weight formula_weight	16314.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

CCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCAC

Entity 3 Entity 3 polymer

Description description	attB53_Rv
Molecular weight formula_weight	16359.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

GTGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCGCGG

Entity 4 Entity 4 polymer

Description description	Recombination directionality factor
Molecular weight formula_weight	30669.3 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	I,J

MSYYHHHHHHDYDIPTTENLYFQGAMAMAKRSIWAGDEDNKPKKRETYADDTVGRFHSGYSETNERGKVVPVALDKWRISTGEQSVADAVAQLFGGTPVENEESTSENFIDVFTDRPKVPVIIEADGIHWDMKLWLNGKLKHHCDGFDFVSHADEEMIGQPCGCPKLFDERKAAAKEYDAPNPAITVTFTLADDPELGRFKFQTGSWTLFKVLHEAEDDVERVGKGGAVLANLELELVEYTPKRGPMRNKLVSYYKPTITVLKSYNDAIAD

Source Source

Source organism organism	Lomovskayavirus C31
NCBI taxonomy ID ncbi_taxonomy_id	10719
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	3.67 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	30771

PhiC31 integraseS12A-attB-RDF complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Integrase

State in the Current Structure

Other States of the Same Protein in the Database

Recombination directionality factor

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9tep__assembly_1__model_1

9tep__assembly_1__model_1 | I(q)

9tep__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

7. Citations (1)

PhiC31 integraseS12A-attB-RDF complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Integrase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Recombination directionality factor

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9tep__assembly_1__model_1

9tep__assembly_1__model_1 | I(q)

9tep__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

7. Citations (1)