SAXSdb — 9ux7

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Lamassu protein LmuB

Bacillus sp. nio-1130

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	Lamassu protein LmuA × 1 （P0DW43） DNA (41-MER) × 1 DNA (41-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	LMUB_BACX1
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–562； UniProt 1–562 Author chain B； PDBConstruct 1–562； UniProt 1–562

Lamassu protein LmuA

Bacillus sp. nio-1130

UniProt P0DW43

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	Lamassu protein LmuB × 2 （P0DW44） DNA (41-MER) × 1 DNA (41-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	LMUA_BACX1
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 1–315； UniProt 1–315

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9ux7
Deposition date deposition_date	2025-05-13
Structure title title	CryoEM Structure of LmuAB-DNA complex
Keywords keywords	complex, anti-phage system, IMMUNE SYSTEM; IMMUNE SYSTEM
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9ux7__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9ux7__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9ux7__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	49.96 Å
Rg (electron density)	49.06 Å
Total Rg	49.28 Å
Atom count	13495
Residues	1510
Excluded volume	237430 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9ux7__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Lamassu protein LmuB
Molecular weight formula_weight	66508.0 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	13495

MIIIAFSILDFKNKEAQNFDFKAGTNLIVSKGNTKGKSSLLKSMYYTLGFDVHQFPSNWNINFMYFQIEVLINNVKYNITRQKNIFRVSDVEVPLNVKEYSEWLQHKLEIKMQLANTHTKHLYEAYSSAVILPFYIDQDDSWDGGIYRNVTNTLNQYTRIPADIFKSVFNLSNYELLELQNSLTNYSKEKNTVVSTIKSLLNVLEDYRHENADVPTVSKIDKIALNKDIDRYLQMQNELNEQIVKYKMKLLNKQEMLDLQKQELSELEQLLKMNKKRYNSIETECQYCHSKLTKEQSLTRLDLSNNYFEISLLKEEIEKEVVKLTNEIIIFESQQNSIESKIDEIHRRIQNSKDLLTIDDYVKATAKKEASNELESLVDKQVLSKYNLEEKIKVLRREINKLKKEKESLREIIERDYTDLVFEIKKVLNDLNDTKLDLSELNLDELKFLEFKKISGSGMDKNKKFLAYYLIYFSLLRKYSSYIIPFCMDSFIKNEITGETAKKMFEAIEKYFFDTNQSFFSIVSENLKHLEFVDSYNKINVEGKLLVRDKYDEIALKFKFDS

Source Source

Source organism organism	Bacillus sp. nio-1130
NCBI taxonomy ID ncbi_taxonomy_id	1761765
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Lamassu protein LmuA
Molecular weight formula_weight	36103.8 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MIEIDNGGAIALKGFNYQKASIILVMIHNFEKDNFIVIPESQEDFEIHLGQDTYFIQVKGTKKLSIGKLKSRPSGKASIIEKNLSPGNVGDIRKIFLWDIAELTKNELISQEGTLIPMKHSLSLKQKTEIINTLDLDEEQKNRMNNQYIYITPFPNDINLALTFLKGEMVNENLLVSNDRAKLVLGELSLEIDRKSEIVVSTESDVERKKIDGNYLKQVFINIKQKEMFDEILDNLSINTIMKKKVKKEKLRIPLLYQNIKEQTKQKADINLLMRENDEGAINYLRDLLVEIVPDMKPTELSIALAIDCFCELGE

Source Source

Source organism organism	Bacillus sp. nio-1130
NCBI taxonomy ID ncbi_taxonomy_id	1761765
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA (41-MER)
Molecular weight formula_weight	12594.1 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACT

Source Source

Source organism organism	synthetic construct
NCBI taxonomy ID ncbi_taxonomy_id	32630
Host organism host_organism	synthetic construct

Entity 4 Entity 4 polymer

Description description	DNA (41-MER)
Molecular weight formula_weight	12647.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

AGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCG

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.730 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	3.73 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	437756

CryoEM Structure of LmuAB-DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Lamassu protein LmuB

State in the Current Structure

Other States of the Same Protein in the Database

Lamassu protein LmuA

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9ux7__assembly_1__model_1

9ux7__assembly_1__model_1 | I(q)

9ux7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

7. Citations (1)

CryoEM Structure of LmuAB-DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Lamassu protein LmuB

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Lamassu protein LmuA

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9ux7__assembly_1__model_1

9ux7__assembly_1__model_1 | I(q)

9ux7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

7. Citations (1)