SAXSdb — 9vku

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-dependent DNA polymerase

Escherichia coli

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 4 RNA 4	RNA (188-MER) × 4 MAGNESIUM ION × 7	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	A0A6D0I497_ECOLX
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–499； UniProt 1–499 Author chain B； PDBConstruct 1–499； UniProt 1–499 Author chain C； PDBConstruct 1–499； UniProt 1–499 Author chain D； PDBConstruct 1–499； UniProt 1–499

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9vku
Deposition date deposition_date	2025-06-23
Structure title title	Cryo-EM structure of DRT9 tetramer complex
Keywords keywords	a protein complex, ANTIVIRAL PROTEIN/RNA, ANTIVIRAL PROTEIN-RNA complex; ANTIVIRAL PROTEIN/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9vku__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9vku__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9vku__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	58.72 Å
Rg (electron density)	55.84 Å
Total Rg	56.35 Å
Atom count	30120
Residues	2629
Excluded volume	488950 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9vku__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	RNA-dependent DNA polymerase
Molecular weight formula_weight	58319.0 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D
Atom count atom_count	30120

MKLEQQIQRVILEEAKALIKDYHEYHNRVHLESVRNKKRLGDSAPDKKIHRPNYWSFDKKFDPFYVKSNYKSIARSIANKIENRTYLPNEPFTKDVPKPDGGIRKVSIYQIPDAAISKLFFNRLLAKNRHRFSSFSYAYRNDRNVHFAIQDISVDLKKNERTFLAEFDFSDFFGSISHSFLNEQFNENGFYISPEEKFIIRSFLRERKVGIPQGTSISLFLANLTCWKLDQDLEREGVKFSRYADDTIIWSQEYSKICNAFNIITNFSKSAGIKINPKKSEGISLLTKKGLPSEITSKNNLDFLGYTLSVENVSIKEKSVKKIKKQISYILYRNLIQPLKKTSLAGQTIPANDRDKNFLIAICEIRRYMYGGLSKSQIKDYLSGRSNRLYFKGIMSFYPLVNDVEQLKQLDGWIVSVIYRALKLRCQLLSKWGYNRSHNFPFILDREDIVDKCSKKTIAGRKLFEIPSFLLIHKALQKGLQESGIEKIMNPQSLNYDYE

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RNA (188-MER)
Molecular weight formula_weight	60361.4 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	E,F,G,H

CAUUCUCUCAUAGGGAUAACGGUGUGGCCUUCUACCUGUUAGAAAUAAUGGGUCUUCAGUUGUAAUUCGUUGCAACUGACGGGGGGGUGGUGUCAAAGCCGUUUCAACCAAGUGGUAACUUACUUUUACUUGGGUUUAUACCGUGGAAAAGCCUGAGUCUAACUCAGGCUUUUUUGUUUAGAGGGCUU

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	7

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.49 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	210060

Cryo-EM structure of DRT9 tetramer complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-dependent DNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9vku__assembly_1__model_1

9vku__assembly_1__model_1 | I(q)

9vku__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

7. Citations (1)

Cryo-EM structure of DRT9 tetramer complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-dependent DNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9vku__assembly_1__model_1

9vku__assembly_1__model_1 | I(q)

9vku__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

7. Citations (1)