SAXSdb — 9xvd

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear factor 1 C-type

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 10–206 Chain C； UniProt 10–206	Not recorded	;DNA (5'-D(APAPGPTPTPGPGPCPAPCPCPGPTPGPCPCPAPAPCPTPT)-3') ; × 1 ;DNA (5'-D(APAPGPTPTPGPGPCPAPCPGPGPTPGPCPCPAPAPCPTPT)-3') ; × 1 EDO 1,2-ETHANEDIOL × 1 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；291 K；0.1 M MES monohydrate (pH 6.0), 22% (v/v) polyethylene glycol (PEG) 400	Resolution 2.60 Å R-free 0.254
2	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain B； UniProt 10–206 Chain D； UniProt 10–206	Not recorded	;DNA (5'-D(APAPGPTPTPGPGPCPAPCPCPGPTPGPCPCPAPAPCPTPT)-3') ; × 1 ;DNA (5'-D(APAPGPTPTPGPGPCPAPCPGPGPTPGPCPCPAPAPCPTPT)-3') ; × 1 EDO 1,2-ETHANEDIOL × 1 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；291 K；0.1 M MES monohydrate (pH 6.0), 22% (v/v) polyethylene glycol (PEG) 400	Resolution 2.60 Å R-free 0.254

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9XVD	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
9XVO Crystal structure of NFIC monomer bound to DNA Deposited 2025-11-26	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 10–175（166 aa） Chain B 10–175（166 aa）	Not recorded	ZN ZINC ION × 2 GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291 K；0.1 M MES monohydrate (pH 6.0) and 14% (w/v) PEG 4000	Resolution 2.50 Å R-free 0.239

1 other PDB entries and 1 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	NFIC_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–198； UniProt 10–206 Author chain B； PDBConstruct 2–198； UniProt 10–206 Author chain C； PDBConstruct 2–198； UniProt 10–206 Author chain D； PDBConstruct 2–198； UniProt 10–206

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9xvd
Deposition date deposition_date	2025-11-26
Structure title title	Crystal structure of NFIC homodimer bound to DNA
Keywords keywords	Transcription factor, DNA BINDING PROTEIN/DNA, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	33.14 Å
Radius of gyration Rg (electron density) rg_electron	32.96 Å
Forward intensity I(0) i0	229466000.00
Molecular weight molecular_weight	106450.0 kDa
Excluded volume excluded_volume	126990 Å³
Envelope volume envelope_volume	172790 Å³
Hydration-shell volume shell_volume	44116 Å³
Envelope diameter envelope_diameter	115.5 Å
Shell Rg shell_rg	39.46 Å
Envelope Rg envelope_rg	32.44 Å
Shape Rg shape_rg	32.98 Å
Total Rg total_rg	33.35 Å
Total atoms total_atoms	7370
Residues n_residues	773
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	108.7 Å
Rg (real space) rg_real	33.10 Å
Rg uncertainty (real space) rg_real_error	0.83 Å
I(0) (real space) i0_real	2.2950e+08
I(0) uncertainty (real space) i0_real_error	3.6030e+06
Rg (reciprocal space) rg_reciprocal	33.12 Å
I(0) (reciprocal space) i0_reciprocal	229500000.0000
Solution quality estimate total_estimate	0.8896
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	38.5 Å
Skewness Skewness skewness	0.312
Kurtosis Kurtosis kurtosis	-0.331
Angular range angular_range	— – 0.2400 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	22940000.0000
Real-space data points n_real_points	49
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.890; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.998; Smooth: 0.893

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Nuclear factor 1 C-type
Molecular weight formula_weight	22872.5 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C,B,D
Atom count atom_count	7542

GQDEFHPFIEALLPHVRAFAYTWFNLQARKRKYFKKHEKRMSKDEERAVKDELLGEKPEVKQKWASRLLAKLRKDIRPECREDFVLSITGKKAPGCVLSNPDQKGKMRRIDCLRQADKVWRLDLVMVILFKGIPLESTDGERLVKAAQCGHPVLCVQPHHIGVAVKELDLYLAYFVRERDAEQSGSPRTGMGSDQEDS

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(APAPGPTPTPGPGPCPAPCPCPGPTPGPCPCPAPAPCPTP*T)-3') ;
Molecular weight formula_weight	6423.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,G

AAGTTGGCACCGTGCCAACTT

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(APAPGPTPTPGPGPCPAPCPGPGPTPGPCPCPAPAPCPTP*T)-3') ;
Molecular weight formula_weight	6463.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F,H

AAGTTGGCACGGTGCCAACTT

Entity 4 Entity 4 non-polymer

Description description	1,2-ETHANEDIOL
Molecular weight formula_weight	62.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	172

▶

8. Citations (1)

▶

Unit-cell length a length_a	83.457 Å
Unit-cell length b length_b	84.290 Å
Unit-cell length c length_c	146.710 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.600 Å
Low-resolution limit resolution_low	18.270 Å
R factor r_factor	0.1945
R_work r_work	0.1912
R_free r_free	0.2536

fit	/app/data/saxs_computation/xv/9xvd/9xvd.fit
pddf	/app/data/pr_computation/xv/9xvd/9xvd.pr.out
profile	/app/data/saxs_computation/xv/9xvd/9xvd.dat

Crystal structure of NFIC homodimer bound to DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear factor 1 C-type

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)