SAXSdb — 9xvo

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear factor 1 C-type

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 10–175 Chain B； UniProt 10–175	Not recorded	;DNA (5'-D(APAPGPTPTPGPGPCPAPCPCPGPTPGPCPCPAPAPCPTPT())-3') ; × 1 ;DNA (5'-D(APAPGPTPTPGPGPCPAPCPGPGPTPGPCPCPAPAPCPTPT())-3') ; × 1 ZN ZINC ION × 2 GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；291 K；0.1 M MES monohydrate (pH 6.0) and 14% (w/v) PEG 4000	Resolution 2.50 Å R-free 0.239

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9XVO	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
9XVD Crystal structure of NFIC homodimer bound to DNA Deposited 2025-11-26	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 10–206（197 aa） Chain C 10–206（197 aa）	Not recorded	EDO 1,2-ETHANEDIOL × 1 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291 K；0.1 M MES monohydrate (pH 6.0), 22% (v/v) polyethylene glycol (PEG) 400	Resolution 2.60 Å R-free 0.254
9XVD Crystal structure of NFIC homodimer bound to DNA Deposited 2025-11-26	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain B 10–206（197 aa） Chain D 10–206（197 aa）	Not recorded	EDO 1,2-ETHANEDIOL × 1 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291 K；0.1 M MES monohydrate (pH 6.0), 22% (v/v) polyethylene glycol (PEG) 400	Resolution 2.60 Å R-free 0.254

1 other PDB entries and 2 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	NFIC_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–167； UniProt 10–175 Author chain B； PDBConstruct 2–167； UniProt 10–175

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9xvo
Deposition date deposition_date	2025-11-26
Structure title title	Crystal structure of NFIC monomer bound to DNA
Keywords keywords	Transcription factor, DNA BINDING PROTEIN/DNA, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	25.81 Å
Radius of gyration Rg (electron density) rg_electron	25.32 Å
Forward intensity I(0) i0	57580100.00
Molecular weight molecular_weight	51160.0 kDa
Excluded volume excluded_volume	60791 Å³
Envelope volume envelope_volume	79326 Å³
Hydration-shell volume shell_volume	26834 Å³
Envelope diameter envelope_diameter	83.7 Å
Shell Rg shell_rg	31.92 Å
Envelope Rg envelope_rg	24.91 Å
Shape Rg shape_rg	25.32 Å
Total Rg total_rg	25.98 Å
Total atoms total_atoms	3537
Residues n_residues	369
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	81.3 Å
Rg (real space) rg_real	25.80 Å
Rg uncertainty (real space) rg_real_error	0.53 Å
I(0) (real space) i0_real	5.7580e+07
I(0) uncertainty (real space) i0_real_error	7.6830e+05
Rg (reciprocal space) rg_reciprocal	25.81 Å
I(0) (reciprocal space) i0_reciprocal	57580000.0000
Solution quality estimate total_estimate	0.9046
Solution quality rating solution_quality	EXCELLENT a EXCELLENT solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	29.3 Å
Skewness Skewness skewness	0.317
Kurtosis Kurtosis kurtosis	-0.445
Angular range angular_range	— – 0.3050 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	4182000.0000
Real-space data points n_real_points	62
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.940; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.996; Smooth: 0.941

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Nuclear factor 1 C-type
Molecular weight formula_weight	19393.8 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	3597

GQDEFHPFIEALLPHVRAFAYTWFNLQARKRKYFKKHEKRMSKDEERAVKDELLGEKPEVKQKWASRLLAKLRKDIRPECREDFVLSITGKKAPGCVLSNPDQKGKMRRIDCLRQADKVWRLDLVMVILFKGIPLESTDGERLVKAAQCGHPVLCVQPHHIGVAVKE

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(APAPGPTPTPGPGPCPAPCPCPGPTPGPCPCPAPAPCPTPT())-3') ;
Molecular weight formula_weight	6423.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

AAGTTGGCACCGTGCCAACTT

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(APAPGPTPTPGPGPCPAPCPGPGPTPGPCPCPAPAPCPTPT())-3') ;
Molecular weight formula_weight	6463.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

AAGTTGGCACGGTGCCAACTT

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	GLYCEROL
Molecular weight formula_weight	92.1 kDa
Source method src_method	nat
Copy count entity_count	2

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	60

▶

8. Citations (1)

▶

Unit-cell length a length_a	61.917 Å
Unit-cell length b length_b	66.273 Å
Unit-cell length c length_c	140.433 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.500 Å
Low-resolution limit resolution_low	33.140 Å
R factor r_factor	0.2059
R_work r_work	0.2041
R_free r_free	0.2387

fit	/app/data/saxs_computation/xv/9xvo/9xvo.fit
pddf	/app/data/pr_computation/xv/9xvo/9xvo.pr.out
profile	/app/data/saxs_computation/xv/9xvo/9xvo.dat

Crystal structure of NFIC monomer bound to DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear factor 1 C-type

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)