← Back to search
9yzu

Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor

Method: X-RAY DIFFRACTION Dmax: 102.4 Å Quality: GOOD
▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Replication initiation protein

Escherichia coli

UniProt P03856

State in the Current Structure

Assembly Oligomeric State Construct Mutations and Modifications Ligands, Ions and Associated Components Method and Experimental Conditions Structure Quality
1 Protein–DNA Heteromer Protein × 4 DNA 2 PDB declaration: hexameric（6） Consistent with all polymer counts Chain C； UniProt 1–251 Not recorded DNA (31-MER) × 1 DNA (31-MER) × 1 General control transcription factor GCN4 × 3 （P03069） MG MAGNESIUM ION × 2 X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；50mM magnesium acetate, 1.8M lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 50mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 33 micromolar bZip Resolution 3.05 Å R-free 0.246

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB Difference from Current Entry 9YZU Assembly / Oligomeric State Construct Mutations and Modifications Ligands, Ions and Non-polymers Method and Experimental Conditions Structure Quality
1REP CRYSTAL STRUCTURE OF REPLICATION INITIATOR PROTEIN REPE54 OF MINI-F PLASMID COMPLEXED WITH AN ITERON DNA Deposited 1999-04-29 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；12 % PEG 400, 200 MM MGCL2, 100 MM TRIS-HCL, PH8.0, VAPOR DIFFUSION, HANGING DROP
Resolution 2.60 Å R-free 0.274
2Z9O Crystal structure of the dimeric form of RepE in complex with the repE operator DNA Deposited 2007-09-21 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric
Chain A 2–251（250 aa）
Chain B 2–251（250 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.2；277 K；10% PEG 4000, 200mM Sodium Chloride, 5mM Samarium Chloride, 100mM HEPES-NaOH, pH 7.2, VAPOR DIFFUSION, SITTING DROP, temperature 277K
Resolution 3.14 Å R-free 0.313
7RVA Updated Crystal Structure of Replication Initiator Protein REPE54. Deposited 2021-08-18 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P NA SODIUM ION × 1 MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；300 mM MgCl2, 18% PEG 400, and 100 mM Tris HCl
Resolution 1.89 Å R-free 0.249
7U6K Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence. Deposited 2022-03-04 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 7 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；400 mM MgCl2, 24% PEG 400, and 80 mM Tris HCl
Resolution 2.38 Å R-free 0.224
7U7O Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional T-A rich sequence. Deposited 2022-03-07 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；300 mM MgCl2, 28% PEG 400, and 80 mM Tris HCl
Resolution 2.97 Å R-free 0.258
7UFX Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and scaffold-insert duplexes (21mer and 10mer) containing the cognate REPE54 sequence and an additional G-C rich sequence, respectively. Deposited 2022-03-23 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 6 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；180 mM MgCl2, 20% PEG 400, and 100 mM Tris HCl
Resolution 2.80 Å R-free 0.226
7UOG Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence. Deposited 2022-04-12 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 5 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；200 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
Resolution 2.63 Å R-free 0.221
7UR0 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and scaffold-insert duplexes (21mer and 10mer) containing the cognate REPE54 sequence and an additional T-A rich sequence, respectively. Deposited 2022-04-20 Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；120 mM MgCl2, 20% PEG 400, 100 mM Tris HCl pH 8.0
Resolution 3.30 Å R-free 0.275
7UV6 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and scaffold duplex (21mer) containing the cognate REPE54 sequence and an insert duplex (10mer) with guest TAMRA-labelled thymine and G-C rich sequence. Deposited 2022-04-29 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 5 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；300 mM MgCl2, 15% PEG 400, and 100 mM Tris HCl
Resolution 2.72 Å R-free 0.224
7UV7 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and scaffold duplex (21mer) containing the cognate REPE54 sequence and an insert duplex (10mer) with guest TAMRA-labelled thymine and T-A rich sequence. Deposited 2022-04-29 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；200 mM MgCl2, 30% PEG 400, 100 mM Tris HCl pH 8.0
Resolution 3.02 Å R-free 0.269
7UXY Isoreticular, interpenetrating co-crystal of protein variant Replication Initiator Protein REPE54 (L53G,Q54G,E55G) and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence. Deposited 2022-05-06 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P,L53G,Q54G,E55G MG MAGNESIUM ION × 8 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；350 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
Resolution 3.15 Å R-free 0.264
8AAN The nucleoprotein complex of Rep protein with iteron containing dsDNA and DUE ssDNA. Deposited 2022-07-01 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric
Chain A 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291.15 K；10% w/v PEG 20 000, 20% v/v PEG MME 550 0.02M of each carboxylic acid (0.2 M sodium formate, 0.2M ammonium acetate, 0.2M trisodium citrate, 0.2M sodium potassium L-tartrate, 0.2M sodium oxamate), 0.1M MES/imidazole pH 6.5.
Resolution 2.19 Å R-free 0.233
8AC8 The nucleoprotein complex of Rep protein with DUE ssDNA Deposited 2022-07-05 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric
Chain C 1–251（251 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291.15 K；PEG 8000, ethylene glycol, HEPES, halogens
Resolution 1.60 Å R-free 0.243
8AC8 The nucleoprotein complex of Rep protein with DUE ssDNA Deposited 2022-07-05 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric
Chain A 1–251（251 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291.15 K；PEG 8000, ethylene glycol, HEPES, halogens
Resolution 1.60 Å R-free 0.243
8D86 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence co-crystallized with a guest small molecule, netropsin. Deposited 2022-06-07 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 5 NT NETROPSIN × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；300 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 3.12 Å R-free 0.234
8D8M Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence grown in a calcium chloride crystallization solution. Deposited 2022-06-08 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P CA CALCIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；400 mM MgCl2, 24% PEG 400, and 80 mM Tris HCl
Resolution 3.10 Å R-free 0.255
8TIP Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with blunt ends and 5' terminal phosphates. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 5 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；400 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 2.79 Å R-free 0.240
8TIQ Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with blunt ends and 3' terminal phosphates. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 6 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 2.45 Å R-free 0.267
8TIR Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 1 sticky bases and 5' terminal phosphates. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；350 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
Resolution 3.11 Å R-free 0.242
8TIS Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 1 sticky bases and 3' terminal phosphates. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 2.54 Å R-free 0.278
8TIT Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and no terminal phosphates. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 6 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；450 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 2.84 Å R-free 0.240
8TIU Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and 3' terminal phosphates. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 5 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；400 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
Resolution 3.90 Å R-free 0.231
8TIV Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with blunt ends and 5' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 3.35 Å R-free 0.260
8TIW Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with blunt ends and 3' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 3.11 Å R-free 0.212
8TIX Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 1 sticky bases and 5' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；350 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
Resolution 2.91 Å R-free 0.228
8TIY Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 1 sticky bases and 3' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 3.11 Å R-free 0.231
8TIZ Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and no terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；450 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
Resolution 3.11 Å R-free 0.217
8TJ0 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and 5' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；400 mM MgCl2, 24% PEG 400, and 80 mM Tris HCl
Resolution 3.24 Å R-free 0.225
8TJ1 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and 3' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：R118P MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；400 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
Resolution 3.15 Å R-free 0.225
9NB0 Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional expansion sequence Deposited 2025-02-13 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；500mM Lithium Sulfate, 20mM Magnesium Acetate, 50mM MES
Resolution 3.20 Å R-free 0.197
9NCR Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional G/C rich expansion sequence Deposited 2025-02-17 Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；1M lithium sulfate, 30mM Magnesium acetate, 50mM MES
Resolution 3.24 Å R-free 0.231
9YZA Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA Deposited 2025-10-30 Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Mutation：L53G, Q54G, E55G MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；10 mM Magnesium acetate, 1300 mM Lithium sulfate, 50 mM MES pH 6.5
Resolution 3.05 Å R-free 0.309
9YZB Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；10 mM Magnesium acetate, 1.6M Lithium sulfate, 50 mM MES pH 6.5
Resolution 4.13 Å R-free 0.253
9YZC Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；80 mM Magnesium acetate, 1.2 M Lithium sulfate, 50 mM MES pH 6.5
Resolution 3.16 Å R-free 0.299
9YZD Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；30 mM Magnesium acetate, 1.3 M Lithium sulfate, 50 mM MES pH 6.5
Resolution 3.09 Å R-free 0.265
9YZE Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；20 mM Magnesium acetate, 300 mM Lithium sulfate, 50 mM MES pH 6.5
Resolution 4.07 Å R-free 0.276
9YZF Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；50 mM Magnesium acetate, 1.1 M Lithium sulfate, 50 mM MES pH 6.5
Resolution 3.07 Å R-free 0.241
9YZG Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA Deposited 2025-10-30 Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；20 mM Magnesium acetate, 1.4 M Lithium sulfate, 50 mM MES pH 6.5
Resolution 3.09 Å R-free 0.301
9YZI Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；50 mM Magnesium acetate, 1.6 M Lithium sulfate, 50 mM MES pH 6.5
Resolution 4.00 Å R-free 0.322
9YZJ Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；30 mM Magnesium acetate, 1.7 M Lithium sulfate, 50 mM MES pH 6.5
Resolution 2.97 Å R-free 0.292
9YZK Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；298 K；60mM Magnesium acetate, 1.6M Lithium sulfate, 50mM MES pH 6.5
Resolution 5.10 Å R-free 0.304
9YZL Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization Deposited 2025-10-30 Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；30mM Magnesium Acetate, 1.2M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 15mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain
Resolution 3.02 Å R-free 0.294
9YZM Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain Deposited 2025-10-30 Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；30mM magnesium acetate, 1.1M lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain.
Resolution 3.07 Å R-free 0.269
9YZN Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；40mM Magnesium acetate, 1.4M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 25mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain.
Resolution 3.16 Å R-free 0.283
9YZO Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；20mM magnesium acetate, 1.7M lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain.
Resolution 2.96 Å R-free 0.312
9YZP Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；40mM Magnesium acetate, 1.5M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 45mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 40 micromolar Ultrabithorax homeodomain.
Resolution 3.67 Å R-free 0.295
9YZQ Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion Deposited 2025-10-30 Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 2 PDB declaration: tetrameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；40mM Magnesium acetate, 1.4M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 45mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 22 micromolar engrailed homeodomain-enhanced Green fluorescent protein fusion
Resolution 3.75 Å R-free 0.338
9YZR Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；30mM magnesium acetate, 900mM Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 48mg/mL EDC overnight, and then looped into a solution of 35mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 80 micromolar Ultrabithorax homeodomain.
Resolution 3.39 Å R-free 0.298
9YZS Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain Deposited 2025-10-30 Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；30mM magnesium acetate, 800mM lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 47.5mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain.
Resolution 3.08 Å R-free 0.291
9YZT Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain Deposited 2025-10-30 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；30mM Magnesium acetate, 1.1M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 47.5mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 23 micromolar Even-skipped homeodomain.
Resolution 3.30 Å R-free 0.292
9Z08 Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing separate insert strand with sequence GACGGTAATT Deposited 2025-10-31 Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；10 mM Magnesium acetate, 1.3 M Lithium sulfate, 50 mM sodium cacodylate pH 6.5
Resolution 4.22 Å R-free 0.254
9Z1A Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC Deposited 2025-11-03 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；80 mM Magnesium Acetate, 1.2 M Lithium Sulfate, 50 mM MES pH 6.5
Resolution 3.10 Å R-free 0.335
9Z1B Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC, crystal soaked in alternate solvent prior to diffraction Deposited 2025-11-03 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded CA CALCIUM ION × 2 K POTASSIUM ION × 3 MG MAGNESIUM ION × 6 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；50mM Magnesium acetate, 1.6M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 40 mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride.
Resolution 3.88 Å R-free 0.308
9Z1C Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC, crystal soaked in alternate solvent prior to diffraction Deposited 2025-11-03 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded K POTASSIUM ION × 3 MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；50mM Magnesium acetate, 1.5M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride.
Resolution 3.04 Å R-free 0.325
9Z1D Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence GCTTGATGAG, crystal soaked in alternate solvent prior to diffraction Deposited 2025-11-03 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；25mM Magnesium acetate, 800mM Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 50mg/mL EDC overnight, and then looped into a solution of 10mM HEPES pH 6.5, 50mM sodium chloride, 2.5 mM magnesium chloride, 800mM lithium sulfate, 15mM magnesium acetate, 25mM MES pH 6.5, and 80 micromolar Ultrabithorax homeodomain.
Resolution 3.06 Å R-free 0.318
9Z44 Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain Deposited 2025-11-08 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric
Chain C 1–251（251 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；60mM magnesium acetate, 1.8M lithium sulfate, 50mM MES pH 6.5.The crystal was crosslinked with 50 mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 90 micromolar C-clamp
Resolution 7.20 Å R-free 0.345
9Z4E Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT and loaded with mutated Bzip region of GCN4 transcription factor Deposited 2025-11-10 Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric
Chain C 1–251（251 aa）
Not recorded MG MAGNESIUM ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；50mM magnesium acetate, 1.6M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 47.5 mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 100 micromolar bZip
Resolution 3.63 Å R-free 0.285
9Z55 Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT Deposited 2025-11-11 Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric
Chain C 1–251（251 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；40mM magnesium acetate, 1.8M lithium sulfate, 50mM MES pH 6.5
Resolution 3.94 Å R-free 0.316

57 other PDB entries and 58 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence
UniProt name REPE1_ECOLI
Isoform —
PDB entities 3
Chains and sequence ranges Author chain C； PDBConstruct 13–263； UniProt 1–251

General control transcription factor GCN4

OrganismNot specified

UniProt P03069

State in the Current Structure

Assembly Oligomeric State Construct Mutations and Modifications Ligands, Ions and Associated Components Method and Experimental Conditions Structure Quality
1 Protein–DNA Heteromer Protein × 4 DNA 2 PDB declaration: hexameric（6） Consistent with all polymer counts Chain D； UniProt 226–251 Chain E； UniProt 226–251 Chain F； UniProt 226–251 Not recorded DNA (31-MER) × 1 DNA (31-MER) × 1 Replication initiation protein × 1 （P03856） MG MAGNESIUM ION × 2 X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；50mM magnesium acetate, 1.8M lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 50mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 33 micromolar bZip Resolution 3.05 Å R-free 0.246

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB Difference from Current Entry 9YZU Assembly / Oligomeric State Construct Mutations and Modifications Ligands, Ions and Non-polymers Method and Experimental Conditions Structure Quality
1CE9 HELIX CAPPING IN THE GCN4 LEUCINE ZIPPER Deposited 1999-03-18 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 251–281（31 aa）
Chain B 251–281（31 aa）
Chain C 251–281（31 aa）
Chain D 251–281（31 aa）
Mutation：R2S,M3V,Q5E Mutation：R2S,M3V,Q5E Mutation：R2S,M3V,Q5E Mutation：R2S,M3V,Q5E No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 4.6；SEE REFERENCE, pH 4.6
Resolution 1.80 Å R-free 0.283
1CE9 HELIX CAPPING IN THE GCN4 LEUCINE ZIPPER Deposited 1999-03-18 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 251–281（31 aa）
Chain D 251–281（31 aa）
Mutation：R2S,M3V,Q5E Mutation：R2S,M3V,Q5E No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 4.6；SEE REFERENCE, pH 4.6
Resolution 1.80 Å R-free 0.283
1CE9 HELIX CAPPING IN THE GCN4 LEUCINE ZIPPER Deposited 1999-03-18 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 3 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 251–281（31 aa）
Chain B 251–281（31 aa）
Mutation：R2S,M3V,Q5E Mutation：R2S,M3V,Q5E No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 4.6；SEE REFERENCE, pH 4.6
Resolution 1.80 Å R-free 0.283
1DGC THE X-RAY STRUCTURE OF THE GCN4-BZIP BOUND TO ATF/CREB SITE DNA SHOWS THE COMPLEX DEPENDS ON DNA FLEXIBILITY Deposited 1993-07-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric
Chain A 220–281（62 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.25；277 K；pH 5.25, VAPOR DIFFUSION, HANGING DROP, temperature 277.00K
Resolution 3.00 Å
1FAV THE STRUCTURE OF AN HIV-1 SPECIFIC CELL ENTRY INHIBITOR IN COMPLEX WITH THE HIV-1 GP41 TRIMERIC CORE Deposited 2000-07-13 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 252–280（29 aa）
Mutation：L2I, V6I, L9I, N13I, L16I, V20I, L23I, V27I No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.9；298 K；25mM PIPES, 0.25M MgAc, 2.5% isopropanol, 10mM Hepes, 37.5mM NaCl, pH 6.9, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K
Resolution 3.00 Å R-free 0.295
1FMH NMR SOLUTION STRUCTURE OF A DESIGNED HETERODIMERIC LEUCINE ZIPPER Deposited 2000-08-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–279（31 aa） Fragment：LEUCINE ZIPPER ACIDIC CHAIN
Chain B 249–279（31 aa） Fragment：LEUCINE ZIPPER BASIC CHAIN
Mutation：R249E M250V K251A D255K K256E E258A E259Q L260A L261E S262A K263E H266Q N269Q R273Q K275E K276H L277E V278C Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：;R249E M250V K251Q Q252A E254K D255K K256R E258Q E259A L261K S262A K263R H266A L267A E268K N269Q E270K A272Q R273A K275R K276H L277K V278C ; Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 5.65；310 K；Ionic strength (raw mmCIF value) 10 mM；Pressure ambient
NMR sample composition 2.1 mM AB zipper; 90% H2O, 10% D2O | 90% H2O/10% D2O
Resolution not provided
1GCL GCN4 LEUCINE ZIPPER CORE MUTANT P-LI Deposited 1993-10-20 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Chain C 249–281（33 aa）
Chain D 249–281（33 aa）
Mutation：L5I,V9L,L12I,N16L,L19I,V23L,L26I,V30L Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L5I,V9L,L12I,N16L,L19I,V23L,L26I,V30L Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L5I,V9L,L12I,N16L,L19I,V23L,L26I,V30L Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L5I,V9L,L12I,N16L,L19I,V23L,L26I,V30L Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 2.10 Å
1GCM GCN4 LEUCINE ZIPPER CORE MUTANT P-LI Deposited 1995-04-25 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Chain C 249–281（33 aa）
Mutation：L5I, V9I, L12I, N16I, L19I, V23I, L26I, V30I (I AT HEPTAD A POSITIONS, I AT HEPTAD D POSITIONS) Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L5I, V9I, L12I, N16I, L19I, V23I, L26I, V30I (I AT HEPTAD A POSITIONS, I AT HEPTAD D POSITIONS) Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L5I, V9I, L12I, N16I, L19I, V23I, L26I, V30I (I AT HEPTAD A POSITIONS, I AT HEPTAD D POSITIONS) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 1.80 Å
1GK6 Human vimentin coil 2B fragment linked to GCN4 leucine zipper (Z2B) Deposited 2001-08-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–279（31 aa） Fragment：Z2B FUSION CONSTRUCT CONTAINING THE GCN4 LEUCINE ZIPPER LINKED TO VIMENTIN RESIDUES 385 - 412
Chain B 249–279（31 aa） Fragment：Z2B FUSION CONSTRUCT CONTAINING THE GCN4 LEUCINE ZIPPER LINKED TO VIMENTIN RESIDUES 385 - 412
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；HANGING DROPS WITH 12.5MG/ML PROTEIN AND 0.55M (NH4)2HPO4, PH ADJUSTED TO 9.0 WITH NAOH, AS PRECIPITANT
Resolution 1.90 Å R-free 0.227
1GZL Crystal structure of C14linkmid/IQN17: a cross-linked inhibitor of HIV-1 entry bound to the gp41 hydrophobic pocket Deposited 2002-05-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 249–276（28 aa） Fragment：GP41 HYDROPHOBIC POCKET, RESIDUES 565-581, GCN4, RESIDUES 249-276
Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 3 N2P PENTANE-1,5-DIAMINE × 3 X-RAY DIFFRACTION
X-ray crystallization conditions pH 8.6；16% ISOPROPANOL, 0.1 M TRIS, PH 8.6, 1 M (NH4)2SO4
Resolution 1.80 Å R-free 0.243
1GZL Crystal structure of C14linkmid/IQN17: a cross-linked inhibitor of HIV-1 entry bound to the gp41 hydrophobic pocket Deposited 2002-05-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain B 249–276（28 aa） Fragment：GP41 HYDROPHOBIC POCKET, RESIDUES 565-581, GCN4, RESIDUES 249-276
Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 3 N2P PENTANE-1,5-DIAMINE × 3 X-RAY DIFFRACTION
X-ray crystallization conditions pH 8.6；16% ISOPROPANOL, 0.1 M TRIS, PH 8.6, 1 M (NH4)2SO4
Resolution 1.80 Å R-free 0.243
1IHQ GLYTM1BZIP: A CHIMERIC PEPTIDE MODEL OF THE N-TERMINUS OF A RAT SHORT ALPHA TROPOMYOSIN WITH THE N-TERMINUS ENCODED BY EXON 1B Deposited 2001-04-19 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 264–281（18 aa）
Chain B 264–281（18 aa）
Not recorded No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 6.4；281 K；Ionic strength (raw mmCIF value) 0.12 N；Pressure atmospheric
NMR sample composition 1-2 mM | 100 mM NaCl, 10 mM phosphate, 10% Deuterium Oxide, pH 6.4
Resolution not provided
1IJ0 Coiled Coil Trimer GCN4-pVLS Ser at Buried D Position Deposited 2001-04-24 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：Coiled coil region
Chain B 249–281（33 aa） Fragment：Coiled coil region
Chain C 249–281（33 aa） Fragment：Coiled coil region
Mutation：L12S, N16V Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L12S, N16V Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L12S, N16V Non-standard monomer：Yes (specific site not provided by mmCIF) ZN ZINC ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；297 K；0.1 M Na Cacodylate, 16% PEG 8000, 0.1 M Zn Acetate, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 297K
Resolution 1.86 Å R-free 0.258
1IJ1 GCN4-pVLT Coiled-coil Trimer with Threonine at the d(12) Position Deposited 2001-04-24 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：COILED COIL REGION
Chain B 249–281（33 aa） Fragment：COILED COIL REGION
Chain C 249–281（33 aa） Fragment：COILED COIL REGION
Mutation：L12T, N16V Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L12T, N16V Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：L12T, N16V Non-standard monomer：Yes (specific site not provided by mmCIF) ZN ZINC ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；298 K；0.1 M Na Cacodylate, 20% PEG 8000, 0.2 M Zn Acetate, pH 6.0, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 1.86 Å R-free 0.278
1IJ2 GCN4-pVTL Coiled-coil Trimer with Threonine at the a(16) position Deposited 2001-04-24 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：COILED COIL REGION
Chain B 249–281（33 aa） Fragment：COILED COIL REGION
Chain C 249–281（33 aa） Fragment：COILED COIL REGION
Mutation：N16T Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16T Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16T Non-standard monomer：Yes (specific site not provided by mmCIF) CD CADMIUM ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；0.1 M HEPES, 25 mM cadmium sulfate, 1 M sodium acetate, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 1.70 Å R-free 0.279
1IJ3 GCN4-pVSL Coiled-coil trimer with Serine at the a(16) position Deposited 2001-04-24 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：coiled coil region
Chain B 249–281（33 aa） Fragment：coiled coil region
Chain C 249–281（33 aa） Fragment：coiled coil region
Mutation：N16S Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16S Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16S Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；298 K；0.1 M MES, 50 mM cesium chloride, 10% PEG 20000, pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 1.80 Å R-free 0.269
1KQL Crystal structure of the C-terminal region of striated muscle alpha-tropomyosin at 2.7 angstrom resolution Deposited 2002-01-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 255–278（24 aa）
Chain B 255–278（24 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.3；295 K；PEG 550 monomethylether, glycerol, sodium chloride, magnesium acetate, bicine, tris buffer, dithiothreitol, pH 8.3, VAPOR DIFFUSION, SITTING DROP, temperature 295K
Resolution 2.70 Å R-free 0.289
1KQL Crystal structure of the C-terminal region of striated muscle alpha-tropomyosin at 2.7 angstrom resolution Deposited 2002-01-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 255–278（24 aa）
Chain B 255–278（24 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.3；295 K；PEG 550 monomethylether, glycerol, sodium chloride, magnesium acetate, bicine, tris buffer, dithiothreitol, pH 8.3, VAPOR DIFFUSION, SITTING DROP, temperature 295K
Resolution 2.70 Å R-free 0.289
1LD4 Placement of the Structural Proteins in Sindbis Virus Deposited 2002-04-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein heterocomplex Heteromer；Protein × 960 PDB declaration: 960-MERIC
Chain E 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain F 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain G 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain H 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain I 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain J 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain K 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain L 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Not recorded UNX UNKNOWN LIGAND × 1920 ELECTRON MICROSCOPY
cryo-EM buffer 50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA；pH 7.5；50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA
Resolution 11.40 Å
1LD4 Placement of the Structural Proteins in Sindbis Virus Deposited 2002-04-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 2 Protein heterocomplex Heteromer；Protein × 16 PDB declaration: hexadecameric
Chain E 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain F 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain G 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain H 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain I 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain J 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain K 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain L 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Not recorded UNX UNKNOWN LIGAND × 32 ELECTRON MICROSCOPY
cryo-EM buffer 50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA；pH 7.5；50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA
Resolution 11.40 Å
1LD4 Placement of the Structural Proteins in Sindbis Virus Deposited 2002-04-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 3 Protein heterocomplex Heteromer；Protein × 80 PDB declaration: 80-meric
Chain E 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain F 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain G 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain H 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain I 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain J 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain K 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain L 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Not recorded UNX UNKNOWN LIGAND × 160 ELECTRON MICROSCOPY
cryo-EM buffer 50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA；pH 7.5；50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA
Resolution 11.40 Å
1LD4 Placement of the Structural Proteins in Sindbis Virus Deposited 2002-04-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 4 Protein heterocomplex Heteromer；Protein × 96 PDB declaration: 96-meric
Chain E 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain F 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain G 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain H 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain I 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain J 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain K 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain L 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Not recorded UNX UNKNOWN LIGAND × 192 ELECTRON MICROSCOPY
cryo-EM buffer 50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA；pH 7.5；50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA
Resolution 11.40 Å
1LD4 Placement of the Structural Proteins in Sindbis Virus Deposited 2002-04-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 5 Protein heterocomplex Heteromer；Protein × 16 PDB declaration: hexadecameric
Chain E 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain F 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain G 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain H 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain I 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain J 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain K 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Chain L 225–281（57 aa） Fragment：LEUCINE-ZIPPER (residues 225-281)
Not recorded UNX UNKNOWN LIGAND × 32 ELECTRON MICROSCOPY
cryo-EM buffer 50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA；pH 7.5；50mM Tris-HCl, 200mM NaCl, 0.1mM EDTA
Resolution 11.40 Å
1LLM Crystal Structure of a Zif23-GCN4 Chimera Bound to DNA Deposited 2002-04-29 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: tetrameric
Chain C 253–281（29 aa）
Chain D 253–281（29 aa）
Not recorded ZN ZINC ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；298 K；bis-tris propane, magnesium chloride, ammonium acetate, pH 8, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 1.50 Å R-free 0.234
1NKN VISUALIZING AN UNSTABLE COILED COIL: THE CRYSTAL STRUCTURE OF AN N-TERMINAL SEGMENT OF THE SCALLOP MYOSIN ROD Deposited 2003-01-03 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.9；289 K；sodium chloride, sodium azide, MOPS, PEG 200 MME, pH 6.9, VAPOR DIFFUSION, HANGING DROP, temperature 289K
Resolution 2.50 Å R-free 0.289
1NKN VISUALIZING AN UNSTABLE COILED COIL: THE CRYSTAL STRUCTURE OF AN N-TERMINAL SEGMENT OF THE SCALLOP MYOSIN ROD Deposited 2003-01-03 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 250–281（32 aa）
Chain D 250–281（32 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.9；289 K；sodium chloride, sodium azide, MOPS, PEG 200 MME, pH 6.9, VAPOR DIFFUSION, HANGING DROP, temperature 289K
Resolution 2.50 Å R-free 0.289
1PIQ CRYSTAL STRUCTURE OF GCN4-PIQ, A TRIMERIC COILED COIL WITH BURIED POLAR RESIDUES Deposited 1998-09-25 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–279（31 aa） Fragment：COILED-COIL DOMAIN
Mutation：L5I, V9I, L12I, N16Q, L19I, V23I, L26I, V30I Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions pH 4.5；PROTEIN WAS CRYSTALLIZED FROM: 75 MM NAAC PH4.5, 20 MM MGCL2 AND 23% MPD
Resolution 1.80 Å R-free 0.236
1RB4 ANTIPARALLEL TRIMER OF GCN4-LEUCINE ZIPPER CORE MUTANT AS N16A TETRAGONAL AUTOMATIC SOLUTION Deposited 2003-11-01 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Chain B 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Chain C 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Mutation：N16A Mutation：N16A Mutation：N16A No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.3；298 K；25 mM phosphate pH 7.3 400 mM NaCl 15% PEG8000, VAPOR DIFFUSION, SITTING DROP, temperature 298K
Resolution 1.90 Å R-free 0.307
1RB5 ANTIPARALLEL TRIMER OF GCN4-LEUCINE ZIPPER CORE MUTANT AS N16A TRIGONAL FORM Deposited 2003-11-01 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Chain B 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Chain C 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Mutation：N16A Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16A Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16A Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.3；298 K；100mM bis-tris, pH 7.3, VAPOR DIFFUSION, SITTING DROP, temperature 298K
Resolution 1.90 Å R-free 0.257
1RB6 ANTIPARALLEL TRIMER OF GCN4-LEUCINE ZIPPER CORE MUTANT AS N16A TETRAGONAL FORM Deposited 2003-11-01 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Chain B 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Chain C 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Mutation：N16A Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16A Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16A Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 8 K POTASSIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.3；298 K；25 mM phosphate 400 mM NaCl 15% PEG8000, pH 7.3, VAPOR DIFFUSION, SITTING DROP, temperature 298K
Resolution 1.90 Å R-free 0.241
1SWI GCN4-LEUCINE ZIPPER CORE MUTANT AS N16A COMPLEXED WITH BENZENE Deposited 1996-05-09 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Chain C 249–281（33 aa）
Mutation：N16A Mutation：N16A Mutation：N16A BNZ BENZENE × 1 X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 2.60 Å
1TMZ TMZIP: A CHIMERIC PEPTIDE MODEL OF THE N-TERMINUS OF ALPHA TROPOMYOSIN, NMR, 15 STRUCTURES Deposited 1998-04-20 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Not recorded No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 6.4；288 K
Resolution not provided
1UNT Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；HANGING DROP, RESERVOIR: 10%W/V PEG 6K, 2 M NACL, PH 7.0
Resolution 2.07 Å R-free 0.286
1UNU Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；HANGING DROP, RESERVOIR: 10%W/V PEG 6K, 2 M NACL, PH 7.0
Resolution 2.07 Å R-free 0.273
1UNV Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；HANGING DROP, RESERVOIR: 10%W/V PEG 6K, 2 M NACL, PH 7.0
Resolution 2.14 Å R-free 0.302
1UNW Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 7；10% W/V PEG 8K, 100 MM TRIS, 200 MM MGCL2, PH 7.0
Resolution 2.20 Å R-free 0.284
1UNX Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 7；2.5 M NACL, 100 MM NAAC, 200 MM LI2SO4, pH 7.00
Resolution 2.40 Å R-free 0.306
1UNY Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 7；2.5 M NACL, 100 MM NAAC, 200 MM LI2SO4, PH 4.5
Resolution 2.30 Å R-free 0.322
1UNZ Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 7；2.5 M NACL, 100 MM NAAC, 200 MM LI2SO4, PH 4.5
Resolution 2.30 Å R-free 0.314
1UO0 Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 7；2.5 M NACL, 100 MM NAAC, 200 MM LI2SO4, PH 4.5
Resolution 2.40 Å R-free 0.299
1UO1 Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 7；2.5 M NACL, 100 MM NAAC, 200 MM LI2SO4, PH 4.5
Resolution 2.50 Å R-free 0.302
1UO2 Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；HANGING DROP, RESERVOIR: 2.5 M NACL, 100 MM NAAC, 200 MM LI2SO4, PH 4.5
Resolution 1.99 Å R-free 0.286
1UO3 Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；HANGING DROP, RESERVOIR: 10%W/V PEG 6K, 2 M NACL, PH 7.0
Resolution 1.92 Å R-free 0.284
1UO4 Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 2 PIH iodobenzene × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；HANGING DROP, RESERVOIR: 10%W/V PEG 6K, 2 M NACL, PH 7.0
Resolution 1.70 Å R-free 0.257
1UO5 Structure Based Engineering of Internal Molecular Surfaces Of Four Helix Bundles Deposited 2003-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 2 PIH iodobenzene × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；HANGING DROP, RESERVOIR: 10%W/V PEG 6K, 2 M NACL, PH 7.0
Resolution 2.07 Å R-free 0.283
1W5G An anti-parallel four helix bundle (acetimide modification). Deposited 2004-08-06 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 10；HANGING DROP, 1UL OF 1MG/ML PEPTIDE IN WATER, 1UL 100MM CAPS, 30% PEG 400, PH 10.5.
Resolution 2.16 Å R-free 0.337
1W5H An anti-parallel four helix bundle. Deposited 2004-08-06 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 10.5；HANGING DROP, 1UL OF 1MG/ML PEPTIDE IN WATER, 1UL 100MM CAPS, 30% PEG 400, PH 10.5.
Resolution 2.50 Å R-free 0.344
1W5I ABA does not affect topology of pLI. Deposited 2004-08-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；HANGING DROP, 1 UL OF 10MG/ML PEPTIDE IN WATER TO 1UL OF 2M NACL 10% PEG 6K.
Resolution 2.30 Å R-free 0.295
1W5J AN ANTI-PARALLEL FOUR HELIX BUNDLE Deposited 2004-08-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；HANGING DROP, 1 UL OF 10 MG/ML PEPTIDE IN WATER TO 1UL OF 0.07M TRI-SODIUM CITRATE DIHYDRATE PH 5.6 0.7M AMMONIUM DIHYDROGEN PHOSPHATE %30 V/V GLYCEROL, HAMPTON CRYSTAL SCREEN CRYO NUMBER 11
Resolution 2.20 Å R-free 0.285
1W5J AN ANTI-PARALLEL FOUR HELIX BUNDLE Deposited 2004-08-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain C 249–281（33 aa）
Chain D 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；HANGING DROP, 1 UL OF 10 MG/ML PEPTIDE IN WATER TO 1UL OF 0.07M TRI-SODIUM CITRATE DIHYDRATE PH 5.6 0.7M AMMONIUM DIHYDROGEN PHOSPHATE %30 V/V GLYCEROL, HAMPTON CRYSTAL SCREEN CRYO NUMBER 11
Resolution 2.20 Å R-free 0.285
1W5K AN ANTI-PARALLEL FOUR HELIX BUNDLE Deposited 2004-08-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5；HANGING DROP, 1UL OF 10MG/ML PEPTIDE IN WATER, 1UL 100MM CAPS, 30% PEG 400, PH 10.5, 1UL OF 50MM TCEP IN WATER
Resolution 1.92 Å R-free 0.307
1W5K AN ANTI-PARALLEL FOUR HELIX BUNDLE Deposited 2004-08-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain C 249–281（33 aa）
Chain D 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5；HANGING DROP, 1UL OF 10MG/ML PEPTIDE IN WATER, 1UL 100MM CAPS, 30% PEG 400, PH 10.5, 1UL OF 50MM TCEP IN WATER
Resolution 1.92 Å R-free 0.307
1W5L An anti-parallel to parallel switch. Deposited 2004-08-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；HANGING DROP, 1 UL OF 10 MG/ML PEPTIDE IN WATER TO 1 UL OF 2M NACL 10% PEG 6K.
Resolution 2.17 Å R-free 0.292
1YSA THE GCN4 BASIC REGION LEUCINE ZIPPER BINDS DNA AS A DIMER OF UNINTERRUPTED ALPHA HELICES: CRYSTAL STRUCTURE OF THE PROTEIN-DNA COMPLEX Deposited 1993-08-09 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric
Chain C 226–281（56 aa）
Chain D 226–281（56 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.75；295 K；pH 5.75, VAPOR DIFFUSION, HANGING DROP, temperature 295.00K TWO ADENINES, B22 AND B23, WHICH ARE NEAR THE 5-PRIME END OF DNA CHAIN B ARE LOOPED OUT OF THE DNA HELIX. THIS CONFORMATION IS PRESENT IN CRYSTALS THAT WERE SOAKED IN 35% (VOL/VOL) POLYETHYLENE GLYCOL MW 400, FOLLOWED BY RAPID FREEZING AND X-RAY DATA COLLECTION AT -155 DEG. CENTIGRADE.
Resolution 2.90 Å
1ZII GCN4-LEUCINE ZIPPER CORE MUTANT ASN16ABA IN THE DIMERIC STATE Deposited 1996-10-30 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：ASN 16 REPLACED WITH AMINOBUTYRIC ACID (ABA) Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：ASN 16 REPLACED WITH AMINOBUTYRIC ACID (ABA) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 1.80 Å
1ZIJ GCN4-LEUCINE ZIPPER CORE MUTANT ASN16ABA IN THE TRIMERIC STATE Deposited 1996-10-30 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Chain C 249–281（33 aa）
Mutation：ASN 16 REPLACED WITH AMINOBUTYRIC ACID (ABA) Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：ASN 16 REPLACED WITH AMINOBUTYRIC ACID (ABA) Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：ASN 16 REPLACED WITH AMINOBUTYRIC ACID (ABA) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 2.00 Å
1ZIK GCN4-LEUCINE ZIPPER CORE MUTANT ASN16LYS IN THE DIMERIC STATE Deposited 1996-10-30 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：N16K Mutation：N16K No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 1.80 Å
1ZIL GCN4-LEUCINE ZIPPER CORE MUTANT ASN16GLN IN THE DIMERIC STATE Deposited 1996-10-30 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Mutation：N16Q Mutation：N16Q No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 2.25 Å
1ZIM GCN4-LEUCINE ZIPPER CORE MUTANT ASN16GLN IN THE TRIMERIC STATE Deposited 1996-10-30 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Chain C 249–281（33 aa）
Mutation：N16Q Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16Q Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16Q Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 2.00 Å
1ZTA THE SOLUTION STRUCTURE OF A LEUCINE-ZIPPER MOTIF PEPTIDE Deposited 1990-10-11 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric
Chain A 247–281（35 aa）
Not recorded No recorded non-water small molecule SOLUTION NMR mmCIF provides none of the parsed conditions Resolution not provided
2AHP GCN4 leucine zipper, mutation of Lys15 to epsilon-azido-Lys Deposited 2005-07-28 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：residues 249-281
Chain B 249–281（33 aa） Fragment：residues 249-281
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；295 K；0.065 M Tris, 5.2% w/v PEG 8000, 35% v/v anhydrous glycerol, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 295K
Resolution 2.00 Å R-free 0.263
2B1F Antiparallel four-stranded coiled coil specified by a 3-3-1 hydrophobic heptad repeat Deposited 2005-09-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 251–281（31 aa）
Chain B 251–281（31 aa）
Chain C 251–281（31 aa）
Chain D 251–281（31 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.2；295 K；Ethanol, Tris-HCl, pH 8.2, VAPOR DIFFUSION, HANGING DROP, temperature 295.0K
Resolution 1.50 Å R-free 0.283
2B22 Antiparallel four-stranded coiled coil specified by a 3-3-1 hydrophobic heptad repeat Deposited 2005-09-16 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 251–281（31 aa）
Not recorded NA SODIUM ION × 8 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；295 K；PEG 400, cadmium chloride, sodium acetate, pH 4.6, VAPOR DIFFUSION, HANGING DROP, temperature 295K
Resolution 2.00 Å R-free 0.276
2BNI pLI mutant E20C L16G Y17H, antiparallel Deposited 2005-03-24 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Chain C 249–281（33 aa）
Chain D 249–281（33 aa）
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；SITTING DROP WITH 200NL 20% PEG 3350 0.2M POTASSIUM THIOCYANATE AND 200NL 20MG/ML PEPTIDE STOCK IN WATER.
Resolution 1.50 Å R-free 0.276
2CCE Parallel Configuration of pLI E20S Deposited 2006-01-16 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa） Fragment：RESIDUES 249-281
Chain B 249–281（33 aa） Fragment：RESIDUES 249-281
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 0；2M NACL, 10% PEG 6K, pH 0.00
Resolution 1.90 Å R-free 0.319
2CCF Antiparallel Configuration of pLI E20S Deposited 2006-01-16 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa） Fragment：RESIDUES 249-281
Chain B 249–281（33 aa） Fragment：RESIDUES 249-281
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 10；100MM CAPS PH 10.5, 30% PEG 400
Resolution 1.70 Å R-free 0.316
2CCN pLI E20C is antiparallel Deposited 2006-01-16 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 249–281（33 aa） Fragment：RESIDUES 249-281
Chain B 249–281（33 aa） Fragment：RESIDUES 249-281
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 10.5；100MM CAPS PH 10.5, 30% PEG 400
Resolution 1.60 Å R-free 0.259
2D3E Crystal structure of the C-Terminal fragment of rabbit skeletal alpha-tropomyosin Deposited 2005-09-27 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 254–277（24 aa） Fragment：residues 151-175, residues 176-284
Chain B 254–277（24 aa） Fragment：residues 151-175, residues 176-284
Chain C 254–277（24 aa） Fragment：residues 151-175, residues 176-284
Chain D 254–277（24 aa） Fragment：residues 151-175, residues 176-284
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.2；293 K；MPD, AMMONIUM ACETATE, SODIUM CITRATE, pH 5.20, VAPOR DIFFUSION, SITTING DROP, temperature 293.0K
Resolution 2.60 Å R-free 0.309
2DGC GCN4 BASIC DOMAIN, LEUCINE ZIPPER COMPLEXED WITH ATF/CREB SITE DNA Deposited 1995-09-28 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric
Chain A 220–281（62 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION；pH 4.6；pH 4.60, VAPOR DIFFUSION
Resolution 2.20 Å R-free 0.316
2EFR Crystal structure of the c-terminal tropomyosin fragment with N- and C-terminal extensions of the leucine zipper at 1.8 angstroms resolution Deposited 2007-02-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–277（29 aa） Fragment：residues 147-175, residues 176-301
Chain B 249–277（29 aa） Fragment：residues 147-175, residues 176-301
Mutation：C190S Mutation：C190S No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；2.2M 1,6-HEXANEDIOL, 0.2M AMMONIUM ACETATE, 0.1M HEPES, PH7.5, pH 7.50, VAPOR DIFFUSION, SITTING DROP
Resolution 1.80 Å R-free 0.316
2EFR Crystal structure of the c-terminal tropomyosin fragment with N- and C-terminal extensions of the leucine zipper at 1.8 angstroms resolution Deposited 2007-02-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 249–277（29 aa） Fragment：residues 147-175, residues 176-301
Chain D 249–277（29 aa） Fragment：residues 147-175, residues 176-301
Mutation：C190S Mutation：C190S No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；2.2M 1,6-HEXANEDIOL, 0.2M AMMONIUM ACETATE, 0.1M HEPES, PH7.5, pH 7.50, VAPOR DIFFUSION, SITTING DROP
Resolution 1.80 Å R-free 0.316
2EFS Crystal structure of the C-terminal tropomyosin fragment with N- and C-terminal extensions of the leucine zipper at 2.0 angstroms resolution Deposited 2007-02-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–277（29 aa） Fragment：residues 147-175, residues 176-301
Chain B 249–277（29 aa） Fragment：residues 147-175, residues 176-301
Mutation：C190S Mutation：C190S No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；293 K；40% MPD, 0.4M AMMONIUM ACETATE 0.1M TRIS-HCL, pH 8.50, VAPOR DIFFUSION, SITTING DROP, temperature 293K
Resolution 2.00 Å R-free 0.304
2EFS Crystal structure of the C-terminal tropomyosin fragment with N- and C-terminal extensions of the leucine zipper at 2.0 angstroms resolution Deposited 2007-02-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 249–277（29 aa） Fragment：residues 147-175, residues 176-301
Chain D 249–277（29 aa） Fragment：residues 147-175, residues 176-301
Mutation：C190S Mutation：C190S No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；293 K；40% MPD, 0.4M AMMONIUM ACETATE 0.1M TRIS-HCL, pH 8.50, VAPOR DIFFUSION, SITTING DROP, temperature 293K
Resolution 2.00 Å R-free 0.304
2G9J Complex of TM1a(1-14)Zip with TM9a(251-284): a model for the polymerization domain ("overlap region") of tropomyosin, Northeast Structural Genomics Target OR9 Deposited 2006-03-06 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 4 PDB declaration: tetrameric
Chain A 264–281（18 aa） Fragment：TM1a(1-14)Zip
Chain B 264–281（18 aa） Fragment：TM1a(1-14)Zip
Not recorded No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 6.5；10 K；Ionic strength (raw mmCIF value) 0.14；Pressure ambient
NMR sample composition 1mM complex of TM1a(1-14)Zip U-15N withTM9a(251-284)U15N, 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5 | 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5
NMR sample composition 1mM complex of TM1a(1-14)Zip U15N/U13C with TM9a(251-284) unlabled, 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5 | 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5
NMR sample composition 1mM complex of TM1a(1-14)Zip U15N/U13C with TM9a(251-284) unlabled, 100 mM NaCl, 10 mM sodium phospate 99.9% deuterium oxide pH 6.5 | 100 mM NaCl, 10 mM sodium phospate 99.9% deuterium oxide pH 6.5
NMR sample composition 1mM complex of TM1a(1-14)Zip unlabeled with TM9a(251-284)U15N/U13C, 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5 or in 99.9% deuterium oxide | 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5 or in 99.9% deuterium oxide
NMR sample composition 1mM complex of TM1a(1-14)Zip unlabeled with TM9a(251-284)U15N/U13C, 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide 99.9% deuterium oxide, pH 6.5 | 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide 99.9% deuterium oxide, pH 6.5
NMR sample composition 1mM complex of TM1a(1-14), one chain labeled U15N/U13C the other chain unlabeled, with unlabeled TM9a(251-284), 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5 | 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5
NMR sample composition 1mM complex of TM9a(251-284), one chain labeled U15N/U13C the other chain unlabeled, with unlabele TM1a(1-14)Zip, 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5 | 100 mM NaCl, 10 mM sodium phospate 10% deuterium oxide pH 6.5
Resolution not provided
2HY6 A seven-helix coiled coil Deposited 2006-08-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 7 PDB declaration: heptameric
Chain A 250–281（32 aa） Fragment：residues 250-281
Chain B 250–281（32 aa） Fragment：residues 250-281
Chain C 250–281（32 aa） Fragment：residues 250-281
Chain D 250–281（32 aa） Fragment：residues 250-281
Chain E 250–281（32 aa） Fragment：residues 250-281
Chain F 250–281（32 aa） Fragment：residues 250-281
Chain G 250–281（32 aa） Fragment：residues 250-281
Mutation：E7A, K9A, L14A, K16A, E21A, E23A, K28A, L30A Mutation：E7A, K9A, L14A, K16A, E21A, E23A, K28A, L30A Mutation：E7A, K9A, L14A, K16A, E21A, E23A, K28A, L30A Mutation：E7A, K9A, L14A, K16A, E21A, E23A, K28A, L30A Mutation：E7A, K9A, L14A, K16A, E21A, E23A, K28A, L30A Mutation：E7A, K9A, L14A, K16A, E21A, E23A, K28A, L30A Mutation：E7A, K9A, L14A, K16A, E21A, E23A, K28A, L30A HEZ HEXANE-1,6-DIOL × 8 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.4；295 K；0.1M potassium dihydrogen phosphate, 1.4M hexanediol, pH 5.4, VAPOR DIFFUSION, HANGING DROP, temperature 295K
Resolution 1.25 Å R-free 0.209
2IPZ A Parallel Coiled-Coil Tetramer with Offset Helices Deposited 2006-10-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Chain C 250–281（32 aa）
Chain D 250–281（32 aa）
Not recorded GOL GLYCEROL × 1 IPA ISOPROPYL ALCOHOL × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.8；295 K；10% Iso-propanol, 20% PEG 4000, 0.1M sodium bromide, 0.1M sodium HEPES, pH 7.8, VAPOR DIFFUSION, HANGING DROP, temperature 295.0K
Resolution 1.35 Å R-free 0.237
2LPB Structure of the complex of the central activation domain of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15 Deposited 2012-02-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric
Chain B 101–134（34 aa） Fragment：Transcriptional activation region, residues 101-134
Not recorded No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 6.5；298 K；Ionic strength (raw mmCIF value) 150；Pressure ambient
NMR sample composition 1-1.2 mM [U-15N] Gal11, 2-2.4 mM Gcn4, 20 mM Sodium phosphate, 150 mM Sodium chloride, 1 mM PMSF, 5 mM DTT, 90% H2O/10% D2O | 90% H2O/10% D2O
NMR sample composition 2-2.4 mM Gal11, 1-1.2 mM [U-15N] Gcn4, 20 mM Sodium phosphate, 150 mM Sodium chloride, 1 mM PMSF, 5 mM DTT, 90% H2O/10% D2O | 90% H2O/10% D2O
NMR sample composition 1-1.2 mM [U-13C; U-15N] Gal11, 2-2.4 mM Gcn4, 20 mM Sodium phosphate, 150 mM Sodium chloride, 1 mM PMSF, 5 mM DTT, 90% H2O/10% D2O | 90% H2O/10% D2O
NMR sample composition 1-1.2 mM [U-13C; U-15N] Gal11, 2-2.4 mM Gcn4, 20 mM Sodium phosphate, 150 mM Sodium chloride, 1 mM PMSF, 5 mM DTT, 100% D2O | 100% D2O
NMR sample composition 2-2.4 mM Gal11, 1-1.2 mM [U-13C; U-15N] Gcn4, 20 mM Sodium phosphate, 150 mM Sodium chloride, 1 mM PMSF, 5 mM DTT, 90% H2O/10% D2O | 90% H2O/10% D2O
Resolution not provided
2N9B Solution NMR Structure of Antiparallel Myosin-10:GCN4 Tandem Coiled-Coil Deposited 2015-11-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 253–280（28 aa）
Chain B 253–280（28 aa）
Not recorded No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 6.5；308 K；Ionic strength (raw mmCIF value) 0.6；Pressure ambient
NMR sample composition 1.1 mM [U-100% 13C; U-100% 15N] entity-1, 100 mM potassium phosphate-2, 1 mM EDTA-3, 0.03 % sodium azide-4, 90% H2O/10% D2O | 90% H2O/10% D2O
Resolution not provided
2NRN Self-assembly of coiled-coil tetramers in the 1.40 A structure of a leucine-zipper mutant Deposited 2006-11-02 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 251–281（31 aa） Fragment：GCN4 leucine zipper
Chain B 251–281（31 aa） Fragment：GCN4 leucine zipper
Chain C 251–281（31 aa） Fragment：GCN4 leucine zipper
Chain D 251–281（31 aa） Fragment：GCN4 leucine zipper
Mutation：E254A, E268A, K275A Mutation：E254A, E268A, K275A Mutation：E254A, E268A, K275A Mutation：E254A, E268A, K275A PO4 PHOSPHATE ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.4；295 K；0.1M sodium citrate, 1M ammonium dihydrophosphate, pH 5.4, VAPOR DIFFUSION, HANGING DROP, temperature 295.0K
Resolution 1.40 Å R-free 0.219
2O7H Crystal structure of trimeric coiled coil GCN4 leucine zipper Deposited 2006-12-11 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：LEUCINE ZIPPER
Chain B 249–281（33 aa） Fragment：LEUCINE ZIPPER
Chain C 249–281（33 aa） Fragment：LEUCINE ZIPPER
Mutation：E22R, K27E Mutation：E22R, K27E Mutation：E22R, K27E No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；293 K；30% 2-Proponal, 0.2M Sodium Citrate, 0.1M Sodium cacodylate, pH 6.0, VAPOR DIFFUSION, SITTING DROP, temperature 293K
Resolution 1.86 Å R-free 0.231
2O7H Crystal structure of trimeric coiled coil GCN4 leucine zipper Deposited 2006-12-11 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain D 249–281（33 aa） Fragment：LEUCINE ZIPPER
Chain E 249–281（33 aa） Fragment：LEUCINE ZIPPER
Chain F 249–281（33 aa） Fragment：LEUCINE ZIPPER
Mutation：E22R, K27E Mutation：E22R, K27E Mutation：E22R, K27E No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；293 K；30% 2-Proponal, 0.2M Sodium Citrate, 0.1M Sodium cacodylate, pH 6.0, VAPOR DIFFUSION, SITTING DROP, temperature 293K
Resolution 1.86 Å R-free 0.231
2OVN NMR structure of the GCN4 trigger peptide Deposited 2007-02-14 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric
Chain A 264–280（17 aa）
Not recorded No recorded non-water small molecule SOLUTION NMR mmCIF provides none of the parsed conditions Resolution not provided
2WG5 Proteasome-Activating Nucleotidase (PAN) N-domain (57-134) from Archaeoglobus fulgidus fused to GCN4 Deposited 2009-04-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 6 PDB declaration: hexameric
Chain A 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain B 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain C 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain D 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain E 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain F 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 100 MM TRIS PH 9.0, 1 M NH4H2PO4, 25% ETHYLENE GLYCOL
Resolution 2.10 Å R-free 0.227
2WG5 Proteasome-Activating Nucleotidase (PAN) N-domain (57-134) from Archaeoglobus fulgidus fused to GCN4 Deposited 2009-04-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 6 PDB declaration: hexameric
Chain G 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain H 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain I 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain J 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain K 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Chain L 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4, RESIDUES 33-56,57-134
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 100 MM TRIS PH 9.0, 1 M NH4H2PO4, 25% ETHYLENE GLYCOL
Resolution 2.10 Å R-free 0.227
2WG6 Proteasome-Activating Nucleotidase (PAN) N-domain (57-134) from Archaeoglobus fulgidus fused to GCN4, P61A Mutant Deposited 2009-04-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 6 PDB declaration: hexameric
Chain A 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain B 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain C 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain D 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain E 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain F 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 100 MM TRIS PH 8.6, 1 M NH4H2PO4, 25% PEG 200
Resolution 2.50 Å R-free 0.222
2WG6 Proteasome-Activating Nucleotidase (PAN) N-domain (57-134) from Archaeoglobus fulgidus fused to GCN4, P61A Mutant Deposited 2009-04-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 6 PDB declaration: hexameric
Chain G 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain H 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain I 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain J 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain K 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Chain L 249–272（24 aa） Fragment：N-DOMAIN (57-134) FUSED TO GCN4,RESIDUES 33-56,57-134
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 100 MM TRIS PH 8.6, 1 M NH4H2PO4, 25% PEG 200
Resolution 2.50 Å R-free 0.222
2WPY GCN4 leucine zipper mutant with one VxxNxxx motif coordinating chloride Deposited 2009-08-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：COILED-COIL DOMAIN, RESIDUES 249-281
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 6 X-RAY DIFFRACTION
X-ray crystallization conditions 3.2 M NACL, 100 MM NA-ACETATE, PH 4.6
Resolution 1.75 Å R-free 0.252
2WPZ GCN4 leucine zipper mutant with two VxxNxxx motifs coordinating chloride Deposited 2009-08-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：COILED-COIL DOMAIN, RESIDUES 249-281
Chain B 249–281（33 aa） Fragment：COILED-COIL DOMAIN, RESIDUES 249-281
Chain C 249–281（33 aa） Fragment：COILED-COIL DOMAIN, RESIDUES 249-281
Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：YES Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions 30% PEG 4000, 200 MM NA-ACETATE, 0.1 M TRIS, PH 8.5
Resolution 1.25 Å R-free 0.223
2WQ0 GCN4 leucine zipper mutant with three IxxNTxx motifs coordinating chloride Deposited 2009-08-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：COILED-COIL DOMAIN, RESIDUES 249-281
Mutation：YES CL CHLORIDE ION × 9 X-RAY DIFFRACTION
X-ray crystallization conditions 2.4 M (NH4)2HPO4, 100 MM TRIS PH 8.5
Resolution 1.12 Å R-free 0.197
2WQ1 GCN4 leucine zipper mutant with three IxxNTxx motifs coordinating bromide Deposited 2009-08-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：COILED-COIL DOMAIN, RESIDUES 249-281
Mutation：YES BR BROMIDE ION × 9 X-RAY DIFFRACTION
X-ray crystallization conditions 20% (W/V) PEG 3350, 200 MM NABR, 100 MM BIS-TRIS PROPANE PH 8.5
Resolution 1.08 Å R-free 0.167
2WQ2 GCN4 leucine zipper mutant with three IxxNTxx motifs coordinating iodide Deposited 2009-08-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：COILED-COIL DOMAIN, RESIDUES 249-281
Mutation：YES IOD IODIDE ION × 9 X-RAY DIFFRACTION
X-ray crystallization conditions 2.4 M (NH4)2HPO4, 100 MM TRIS PH 8.5
Resolution 1.36 Å R-free 0.184
2WQ3 GCN4 leucine zipper mutant with three IxxNTxx motifs coordinating chloride and nitrate Deposited 2009-08-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：COILED-COIL DOMAIN, RESIDUES 249-281
Mutation：YES CL CHLORIDE ION × 6 NO3 NITRATE ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions 25,5% (W/V) PEG 4000, 15% (V/V) GLYCEROL, 170MM NA-ACETATE, 90MM TRIS PH 8.5
Resolution 1.22 Å R-free 0.200
2YNY Salmonella enterica SadA 255-302 fused to GCN4 adaptors (SadAK1) Deposited 2012-10-20 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–278（29 aa） Fragment：GCN4 AT EITHER END, RESIDUES 250-278. ADHESIN, RESIDUES 255-302
Chain B 250–278（29 aa） Fragment：GCN4 AT EITHER END, RESIDUES 250-278. ADHESIN, RESIDUES 255-302
Chain C 250–278（29 aa） Fragment：GCN4 AT EITHER END, RESIDUES 250-278. ADHESIN, RESIDUES 255-302
Mutation：YES Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 16% (W/V) PEG 4000, 80 MM SODIUM ACETATE, 100 MM HEPES PH 7.5
Resolution 1.35 Å R-free 0.198
2YNZ Salmonella enterica SadA 823-947 fused to a GCN4 adaptor (SadAK5) Deposited 2012-10-20 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–278（29 aa） Fragment：GCN ADAPTOR RESIDUES, 250-278, ADHESIN RESIDUES 823-947
Chain B 250–278（29 aa） Fragment：GCN ADAPTOR RESIDUES, 250-278, ADHESIN RESIDUES 823-947
Chain C 250–278（29 aa） Fragment：GCN ADAPTOR RESIDUES, 250-278, ADHESIN RESIDUES 823-947
Mutation：YES Mutation：YES Mutation：YES NO3 NITRATE ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions 10% (W/V) PEG 10000, 200 MM MAGNESIUM NITRATE
Resolution 1.40 Å R-free 0.232
2YO0 Salmonella enterica SadA 1049-1304 fused to GCN4 adaptors (SadAK9-cfI) Deposited 2012-10-20 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–278（29 aa） Fragment：GCN4 ADAPTOR, RESIDUES 250-278, ADHESIN, RESIDUES 1049-1304
Mutation：YES CL CHLORIDE ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions 20% (V/V) BUTANEDIOL, 100 MM SODIUM ACETATE PH 4.5
Resolution 2.80 Å R-free 0.297
2YO1 Salmonella enterica SadA 1049-1304 fused to GCN4 adaptors (SadAK9- cfII) Deposited 2012-10-20 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–278（29 aa） Fragment：RESIDUES 1049-1304 FUSED TO GCN4 ADAPTORS, RESIDUES 250-278
Chain B 250–278（29 aa） Fragment：RESIDUES 1049-1304 FUSED TO GCN4 ADAPTORS, RESIDUES 250-278
Chain C 250–278（29 aa） Fragment：RESIDUES 1049-1304 FUSED TO GCN4 ADAPTORS, RESIDUES 250-278
Mutation：YES Mutation：YES Mutation：YES CL CHLORIDE ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions 15 % (V/V) BUTANEDIOL, 100 MM SODIUM ACETATE PH 4.2
Resolution 3.10 Å R-free 0.320
2YO2 Salmonella enterica SadA 255-358 fused to GCN4 adaptors (SadAK12) Deposited 2012-10-20 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–278（29 aa） Fragment：RESIDUES 255-358 FUSED TO GCN4 ADAPTORS AT EITHER END, RESIDUES 250-278
Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 500 MM AMMONIUM TARTRATE, 100 MM SODIUM ACETATE PH 5.0
Resolution 2.00 Å R-free 0.284
2YO3 Salmonella enterica SadA 1185-1386 fused to GCN4 adaptors (SadAK14) Deposited 2012-10-20 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–278（29 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 1185-1386, GCN4 ADAPTOR RESIDUES 250-278
Chain B 250–278（29 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 1185-1386, GCN4 ADAPTOR RESIDUES 250-278
Chain C 250–278（29 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 1185-1386, GCN4 ADAPTOR RESIDUES 250-278
Mutation：YES Mutation：YES Mutation：YES CL CHLORIDE ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions 12% (W/V) PEG 8000, 100 MM MAGNESIUM ACETATE, 100 MM TRIS PH 8.5
Resolution 2.00 Å R-free 0.253
2Z5H Crystal structure of the head-to-tail junction of tropomyosin complexed with a fragment of TnT Deposited 2007-07-12 Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 4 PDB declaration: tetrameric
Chain A 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain B 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain I 267–278（12 aa） Fragment：N terminal domain of Tropomyosin alpha-1 chain and C terminal domain of GCN4
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.89 Å R-free 0.247
2Z5H Crystal structure of the head-to-tail junction of tropomyosin complexed with a fragment of TnT Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain D 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.89 Å R-free 0.247
2Z5H Crystal structure of the head-to-tail junction of tropomyosin complexed with a fragment of TnT Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 3 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain E 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain F 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.89 Å R-free 0.247
2Z5H Crystal structure of the head-to-tail junction of tropomyosin complexed with a fragment of TnT Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 4 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain G 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain H 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.89 Å R-free 0.247
2Z5I Crystal structure of the head-to-tail junction of tropomyosin Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain B 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.10 Å R-free 0.246
2Z5I Crystal structure of the head-to-tail junction of tropomyosin Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain D 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.10 Å R-free 0.246
2Z5I Crystal structure of the head-to-tail junction of tropomyosin Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 3 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain E 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain F 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.10 Å R-free 0.246
2Z5I Crystal structure of the head-to-tail junction of tropomyosin Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 4 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain G 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain H 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.10 Å R-free 0.246
2Z5I Crystal structure of the head-to-tail junction of tropomyosin Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 5 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain I 267–278（12 aa） Fragment：N terminal domain of Tropomyosin alpha-1 chain and C terminal domain of GCN4
Chain J 267–278（12 aa） Fragment：N terminal domain of Tropomyosin alpha-1 chain and C terminal domain of GCN4
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.10 Å R-free 0.246
2Z5I Crystal structure of the head-to-tail junction of tropomyosin Deposited 2007-07-12 Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 6 Insufficient information Homooligomer；Protein × 10 PDB declaration: decameric
Chain A 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain B 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain C 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain D 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain E 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain F 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain G 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain H 259–278（20 aa） Fragment：C terminal domain of GCN4 and Tropomyosin alpha-1 chain
Chain I 267–278（12 aa） Fragment：N terminal domain of Tropomyosin alpha-1 chain and C terminal domain of GCN4
Chain J 267–278（12 aa） Fragment：N terminal domain of Tropomyosin alpha-1 chain and C terminal domain of GCN4
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293 K；pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.10 Å R-free 0.246
2ZTA X-RAY STRUCTURE OF THE GCN4 LEUCINE ZIPPER, A TWO-STRANDED, PARALLEL COILED COIL Deposited 1991-07-05 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 1.80 Å
3AZD Crystal structure of tropomyosin N-terminal fragment at 0.98A resolution Deposited 2011-05-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 264–281（18 aa）
Chain B 264–281（18 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；293 K；0.17M ammonium sulfate, 10% PEG 4000, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 0.98 Å R-free 0.171
3BAS Crystal structure of the N-terminal region of the scallop myosin rod, monoclinic (C2) form Deposited 2007-11-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–281（32 aa） Fragment：Bay Scallop Myosin (Residues 835-885)/Yeast GCN4 Transcription Factor (Residues 250-281)
Chain B 250–281（32 aa） Fragment：Bay Scallop Myosin (Residues 835-885)/Yeast GCN4 Transcription Factor (Residues 250-281)
Not recorded IOD IODIDE ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.2；277 K；1.5 microliter of protein solution (4 mg/ml protein in 30 mM MOPS buffer pH 7.2, 40 mM NaCl, 2 mM NaN3) mixed with 3 microliters of (16.6% PEG 3350, 4.6% MPD, 13 mM NaCl, 2 mM NaN3, 10 mM MOPS pH 7.2) and equilibrated against (15% PEG 3350, 4.2% MPD, 18 mM MOPS, 24 mM NaCl), VAPOR DIFFUSION, HANGING DROP, temperature 277K
Resolution 2.30 Å R-free 0.287
3BAT Crystal structure of the N-terminal region of the scallop myosin rod, monoclinic (P21) form Deposited 2007-11-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–281（32 aa） Fragment：Bay Scallop Myosin (Residues 835-885)/Yeast GCN4 Transcription Factor (Residues 250-281)
Chain B 250–281（32 aa） Fragment：Bay Scallop Myosin (Residues 835-885)/Yeast GCN4 Transcription Factor (Residues 250-281)
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；277 K；2 microliters of protein solution (4 mg/ml protein in 30 mM MOPS buffer pH 7.2, 40 mM NaCl, 2 mM NaN3) mixed with 2 microliters of (25% PEG 3350, 50 mM NH4I) and equilibrated against 1 ml of (17.5% PEG 3350, 35 mM NH4I, 28 mM NaCl, 2 mM NaN3, 20 mM MOPS pH 6.2). Harvested crystals were cryoprotected in 25.5% PEG 3350 and 15% glycerol, VAPOR DIFFUSION, HANGING DROP, temperature 277K
Resolution 2.30 Å R-free 0.299
3BAT Crystal structure of the N-terminal region of the scallop myosin rod, monoclinic (P21) form Deposited 2007-11-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 250–281（32 aa） Fragment：Bay Scallop Myosin (Residues 835-885)/Yeast GCN4 Transcription Factor (Residues 250-281)
Chain D 250–281（32 aa） Fragment：Bay Scallop Myosin (Residues 835-885)/Yeast GCN4 Transcription Factor (Residues 250-281)
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；277 K；2 microliters of protein solution (4 mg/ml protein in 30 mM MOPS buffer pH 7.2, 40 mM NaCl, 2 mM NaN3) mixed with 2 microliters of (25% PEG 3350, 50 mM NH4I) and equilibrated against 1 ml of (17.5% PEG 3350, 35 mM NH4I, 28 mM NaCl, 2 mM NaN3, 20 mM MOPS pH 6.2). Harvested crystals were cryoprotected in 25.5% PEG 3350 and 15% glycerol, VAPOR DIFFUSION, HANGING DROP, temperature 277K
Resolution 2.30 Å R-free 0.299
3CK4 A heterospecific leucine zipper tetramer Deposited 2008-03-14 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 251–281（31 aa） Fragment：UNP residues 251-281
Chain B 251–281（31 aa） Fragment：UNP residues 251-281
Chain C 251–281（31 aa） Fragment：UNP residues 251-281
Chain D 251–281（31 aa） Fragment：UNP residues 251-281
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；295 K；0.1M Tris-HCl, 0.2M magnesium chloride, 30% PEG 4000, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 295K
Resolution 1.70 Å R-free 0.221
3CK4 A heterospecific leucine zipper tetramer Deposited 2008-03-14 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain E 251–281（31 aa） Fragment：UNP residues 251-281
Chain F 251–281（31 aa） Fragment：UNP residues 251-281
Chain G 251–281（31 aa） Fragment：UNP residues 251-281
Chain H 251–281（31 aa） Fragment：UNP residues 251-281
Not recorded MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；295 K；0.1M Tris-HCl, 0.2M magnesium chloride, 30% PEG 4000, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 295K
Resolution 1.70 Å R-free 0.221
3CK4 A heterospecific leucine zipper tetramer Deposited 2008-03-14 Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics Assembly 3 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain I 251–281（31 aa） Fragment：UNP residues 251-281
Chain J 251–281（31 aa） Fragment：UNP residues 251-281
Chain K 251–281（31 aa） Fragment：UNP residues 251-281
Chain L 251–281（31 aa） Fragment：UNP residues 251-281
Not recorded MG MAGNESIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；295 K；0.1M Tris-HCl, 0.2M magnesium chloride, 30% PEG 4000, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 295K
Resolution 1.70 Å R-free 0.221
3CRP A heterospecific leucine zipper tetramer Deposited 2008-04-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 251–281（31 aa） Fragment：UNP residues 251-281
Chain B 251–281（31 aa） Fragment：UNP residues 251-281
Chain C 251–281（31 aa） Fragment：UNP residues 251-281
Chain D 251–281（31 aa） Fragment：UNP residues 251-281
Not recorded NA SODIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9.8；295 K；0.1M Tris-HCl, 0.05M magnesium chloride, 13% PEG 4000, pH 9.8, VAPOR DIFFUSION, HANGING DROP, temperature 295.0K
Resolution 1.70 Å R-free 0.230
3CRP A heterospecific leucine zipper tetramer Deposited 2008-04-07 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain E 251–281（31 aa） Fragment：UNP residues 251-281
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9.8；295 K；0.1M Tris-HCl, 0.05M magnesium chloride, 13% PEG 4000, pH 9.8, VAPOR DIFFUSION, HANGING DROP, temperature 295.0K
Resolution 1.70 Å R-free 0.230
3G9R Structure of the HIV-1 gp41 Membrane-Proximal Ectodomain Region in a Putative Prefusion Conformation Deposited 2009-02-13 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 258–276（19 aa） Fragment：C-terminal MPER of HIV-1 GP41, Leucine-zipper domain of GCN4
Chain B 258–276（19 aa） Fragment：C-terminal MPER of HIV-1 GP41, Leucine-zipper domain of GCN4
Chain C 258–276（19 aa） Fragment：C-terminal MPER of HIV-1 GP41, Leucine-zipper domain of GCN4
Mutation：L27K, N30I, Y31K, H32R, L33I, V37I, A38K, L40I Mutation：L27K, N30I, Y31K, H32R, L33I, V37I, A38K, L40I Mutation：L27K, N30I, Y31K, H32R, L33I, V37I, A38K, L40I PO4 PHOSPHATE ION × 4 MPD (4S)-2-METHYL-2,4-PENTANEDIOL × 6 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；298 K；0.1M sodium HEPES, 0.1M ammonium dihydrogenphosphate, 50% MPD, pH 7.6, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K
Resolution 2.00 Å R-free 0.269
3G9R Structure of the HIV-1 gp41 Membrane-Proximal Ectodomain Region in a Putative Prefusion Conformation Deposited 2009-02-13 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain D 258–276（19 aa） Fragment：C-terminal MPER of HIV-1 GP41, Leucine-zipper domain of GCN4
Chain E 258–276（19 aa） Fragment：C-terminal MPER of HIV-1 GP41, Leucine-zipper domain of GCN4
Chain F 258–276（19 aa） Fragment：C-terminal MPER of HIV-1 GP41, Leucine-zipper domain of GCN4
Mutation：L27K, N30I, Y31K, H32R, L33I, V37I, A38K, L40I Mutation：L27K, N30I, Y31K, H32R, L33I, V37I, A38K, L40I Mutation：L27K, N30I, Y31K, H32R, L33I, V37I, A38K, L40I PO4 PHOSPHATE ION × 1 MPD (4S)-2-METHYL-2,4-PENTANEDIOL × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；298 K；0.1M sodium HEPES, 0.1M ammonium dihydrogenphosphate, 50% MPD, pH 7.6, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K
Resolution 2.00 Å R-free 0.269
3GJP Crystal structure of mutant coiled coil GCN4 leucine zipper Deposited 2009-03-09 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：Leucine zipper
Chain B 249–281（33 aa） Fragment：Leucine zipper
Chain C 249–281（33 aa） Fragment：Leucine zipper
Mutation：V271I,L274I Mutation：V271I,L274I Mutation：V271I,L274I No recorded non-water small molecule X-RAY DIFFRACTION mmCIF provides none of the parsed conditions Resolution 2.00 Å R-free 0.269
3I1G Crystal structure of a GCN4 leucine zipper mutant at 1.6 A resolution Deposited 2009-06-26 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：Leucine zipper domain: UNP residues 249-281
Mutation：K251A, D255A, Y265W, H266N No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.5；298 K；Protein solution: 8 mg/mL Leucine zipper peptide, 0.1 M Sodium acetate pH 4.5. Reservoir solution: 0.2 M CaCl2, 0.1 M Sodium acetate pH 4.5, 20 % v/v Isopropanol, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K
Resolution 1.60 Å R-free 0.287
3I5C Crystal structure of a fusion protein containing the leucine zipper of GCN4 and the GGDEF domain of WspR from Pseudomonas aeruginosa Deposited 2009-07-03 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–278（30 aa） Fragment：GCN4 leucine zipper fused with GGDEF domain
Chain B 249–278（30 aa） Fragment：GCN4 leucine zipper fused with GGDEF domain
Not recorded MG MAGNESIUM ION × 1 C2E 9,9'-[(2R,3R,3aS,5S,7aR,9R,10R,10aS,12S,14aR)-3,5,10,12-tetrahydroxy-5,12-dioxidooctahydro-2H,7H-difuro[3,2-d:3',2'-j][1,3,7,9,2,8]tetraoxadiphosphacyclododecine-2,9-diyl]bis(2-amino-1,9-dihydro-6H-purin-6-one) × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；298 K；Magnesium formate dihydrate, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K
Resolution 1.94 Å R-free 0.259
3K7Z GCN4-Leucine zipper core mutant as N16A trigonal automatic solution Deposited 2009-10-13 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Chain B 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Chain C 249–281（33 aa） Fragment：LEUCINE-ZIPPER (RESIDUES 249-281)
Mutation：N16A Mutation：N16A Mutation：N16A No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.3；298 K；100MM BIS-TRIS buffer only, pH 7.3, VAPOR DIFFUSION, SITTING DROP, temperature 298K
Resolution 1.90 Å R-free 0.259
3M48 GCN4 Leucine Zipper Peptide Mutant Deposited 2010-03-10 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：Leucine Zipper domain (UNP residues 249-281)
Mutation：K251A, D255A, Y265W, H266N NA SODIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION；pH 4.6；298 K；8 mg/ml leucine zipper peptide, 0.1M sodium acetate, 0.2M calcium chloride, 20% v/v 2-propanol, pH 4.6, VAPOR DIFFUSION, temperature 298K
Resolution 1.45 Å R-free 0.225
3P8M Human dynein light chain (DYNLL2) in complex with an in vitro evolved peptide dimerized by leucine zipper Deposited 2010-10-14 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric
Chain C 250–281（32 aa）
Chain D 250–281（32 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions pH 7；293 K；20% PEG8000, 0.2 M MgCl2, 0.1 M TRIS, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Resolution 2.90 Å R-free 0.295
3ZMF Salmonella enterica SadA 303-358 fused to GCN4 adaptors (SadAK2) Deposited 2013-02-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain C 250–277（28 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 303-358, GCN4 ADAPTOR RESIDUES 250-278
Chain C 250–278（29 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 303-358, GCN4 ADAPTOR RESIDUES 250-278
Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 50% PEG 200, 0.1 M NA-CITRATE PH 5.5
Resolution 1.85 Å R-free 0.221
3ZMF Salmonella enterica SadA 303-358 fused to GCN4 adaptors (SadAK2) Deposited 2013-02-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain B 250–277（28 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 303-358, GCN4 ADAPTOR RESIDUES 250-278
Chain B 250–278（29 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 303-358, GCN4 ADAPTOR RESIDUES 250-278
Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 50% PEG 200, 0.1 M NA-CITRATE PH 5.5
Resolution 1.85 Å R-free 0.221
3ZMF Salmonella enterica SadA 303-358 fused to GCN4 adaptors (SadAK2) Deposited 2013-02-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 3 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 303-358, GCN4 ADAPTOR RESIDUES 250-278
Chain A 250–278（29 aa） Fragment：GCN4 ADAPTOR RESIDUES 250-278, ADHESIN RESIDUES 303-358, GCN4 ADAPTOR RESIDUES 250-278
Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 50% PEG 200, 0.1 M NA-CITRATE PH 5.5
Resolution 1.85 Å R-free 0.221
4C46 ANDREI-N-LVPAS fused to GCN4 adaptors Deposited 2013-08-30 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–278（29 aa） Fragment：RESIDUES 250-278,250-278
Chain B 250–278（29 aa） Fragment：RESIDUES 250-278,250-278
Chain C 250–278（29 aa） Fragment：RESIDUES 250-278,250-278
Mutation：YES Mutation：YES Mutation：YES BR BROMIDE ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 4；SITTING DROP, PROTEIN SOLUTION 50 MM NACL AND 50 MM SODIUM ACETATE PH 4.0, RESERVOUR SOLUTION 0.1 M HEPES PH 7.5 1.75 M SODIUM BROMIDE
Resolution 1.95 Å R-free 0.275
4G2K Crystal structure of the Marburg Virus GP2 ectodomain in its post-fusion conformation Deposited 2012-07-12 Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–279（30 aa） Fragment：SEE REMARK 999
Chain B 250–279（30 aa） Fragment：SEE REMARK 999
Chain C 250–279（30 aa） Fragment：SEE REMARK 999
Not recorded GOL GLYCEROL × 2 CL CHLORIDE ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；298 K；0.17 M sodium acetate, 0.085 M Tris-HCl, pH 8.5, 25.5% PEG3350, 15% glycerol, VAPOR DIFFUSION, SITTING DROP, temperature 298K
Resolution 1.90 Å R-free 0.244
4HU5 Oxime side-chain cross-links in the GCN4-p1 dimeric coiled coil: Linear precursor Deposited 2012-11-02 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) GOL GLYCEROL × 1 ACT ACETATE ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.1 M sodium acetate pH 4.6, 1.6 M sodium chloride, 5% w/v PEG 1500, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 2.30 Å R-free 0.268
4HU6 Oxime side-chain cross-links in the GCN4-p1 dimeric coiled coil: Cyclic product Deposited 2012-11-02 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) ACT ACETATE ION × 2 GOL GLYCEROL × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.1 M sodium acetate pH 4.6, 1.6 M sodium chloride, 5% w/v PEG 1500; crystal was treated with 1 equiv. sodium periodate relative to protein and allowed to incubate for 2 days prior to harvesting, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 2.30 Å R-free 0.292
4HU6 Oxime side-chain cross-links in the GCN4-p1 dimeric coiled coil: Cyclic product Deposited 2012-11-02 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 249–281（33 aa）
Chain D 249–281（33 aa）
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) GOL GLYCEROL × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.1 M sodium acetate pH 4.6, 1.6 M sodium chloride, 5% w/v PEG 1500; crystal was treated with 1 equiv. sodium periodate relative to protein and allowed to incubate for 2 days prior to harvesting, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 2.30 Å R-free 0.292
4NIZ GCN4-p1 single Val9 to aminobutyric acid mutant Deposited 2013-11-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：unp residues 249-281
Chain B 249–281（33 aa） Fragment：unp residues 249-281
Mutation：V9(ABA) Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：V9(ABA) Non-standard monomer：Yes (specific site not provided by mmCIF) GOL GLYCEROL × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；298 K；0.05 M sodium acetate, 0.1 M sodium citrate tribasic dihydrate, 20% w/v PEG 4000, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 2.00 Å R-free 0.243
4NJ0 GCN4-p1 single Val9 to Ile mutant Deposited 2013-11-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：unp residues 249-281
Chain B 249–281（33 aa） Fragment：unp residues 249-281
Mutation：V9I Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：V9I Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；298 K；0.2 M sodium acetate, 0.1 M sodium citrate tribasic dihydrate, 25% w/v PEG 4000, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 1.90 Å R-free 0.283
4NJ1 GCN4-p1 double Val9, 23 to Ile mutant Deposited 2013-11-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：unp residues 249-281
Chain B 249–281（33 aa） Fragment：unp residues 249-281
Mutation：V9I, V23I Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：V9I, V23I Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；298 K；0.1 M soduim aceteate, 0.1 M sodium citrate tribasic dihyrdrate, 20% w/v PEG 4000, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 2.00 Å R-free 0.255
4NJ2 GCN4-p1 triple Val9, 23,30 to Ile mutant Deposited 2013-11-08 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：unp residues 249-281
Chain B 249–281（33 aa） Fragment：unp residues 249-281
Mutation：V29I, V30I, V31I Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：V29I, V30I, V31I Non-standard monomer：Yes (specific site not provided by mmCIF) GOL GLYCEROL × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；298 K；0.15M sodium citrate tribasic dihydrate, 20% v/v 2-propanol, 15% w/v PEG 4000, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 298K
Resolution 2.20 Å R-free 0.313
4TL1 GCN4-p1 with mutation to 1-Aminocyclohexanecarboxylic acid at residue 10 Deposited 2014-05-28 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：UNP residues 249-281
Chain B 249–281（33 aa） Fragment：UNP residues 249-281
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) IPA ISOPROPYL ALCOHOL × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；298 K；0.2 M sodium citrate tribasic, 0.1 M sodium cacodylate pH 6.5, 30% v/v isopropanol
Resolution 1.80 Å R-free 0.228
5APP Actinobacillus actinomycetemcomitans OMP100 residues 133-198 fused to GCN4 adaptors Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa） Fragment：;UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277,UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277,UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277 ;
Chain B 250–277（28 aa） Fragment：;UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277,UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277,UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277 ;
Chain C 250–277（28 aa） Fragment：;UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277,UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277,UNP RESIDUES P03069 250-277, G4B386 133-199, P03069 250-277 ;
Mutation：YES,YES,YES Mutation：YES,YES,YES Mutation：YES,YES,YES CL CHLORIDE ION × 5 X-RAY DIFFRACTION
X-ray crystallization conditions 0.1 M TRI-SODIUM CITRATE PH 5.5, 2 %(V/V) DIOXANE 15 %(W/V) PEG 10,000
Resolution 2.30 Å R-free 0.254
5APQ Sequence IENKAD inserted between GCN4 adaptors - Structure A6 Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain A 250–281（32 aa）
Chain B 250–277（28 aa）
Chain B 250–281（32 aa）
Chain C 250–277（28 aa）
Chain C 250–281（32 aa）
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 95 MM TRI-SODIUM CITRATE PH 5.6, 19 %(V/V) ISOPROPANOL, 19 %(W/V) PEG 4000, 5 %(V/V) GLYCEROL
Resolution 2.10 Å R-free 0.251
5APS Sequence IENKKAD inserted between GCN4 adaptors - Structure A7 Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain A 250–281（32 aa）
Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 0.1 M CITRIC ACID PH 3.5, 3 M NACL
Resolution 1.37 Å R-free 0.238
5APT Sequence IENKADKAD inserted between GCN4 adaptors - Structure A9 Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain A 250–281（32 aa）
Chain B 250–277（28 aa）
Chain B 250–281（32 aa）
Chain C 250–277（28 aa）
Chain C 250–281（32 aa）
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 1.6 M TRI-SODIUM CITRATE PH 6.5
Resolution 1.80 Å R-free 0.256
5APU Sequence IANKEDKAD inserted between GCN4 adaptors - Structure A9b black Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain A 250–281（32 aa）
Chain B 250–277（28 aa）
Chain B 250–281（32 aa）
Chain C 250–277（28 aa）
Chain C 250–281（32 aa）
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES URE UREA × 1 X-RAY DIFFRACTION
X-ray crystallization conditions 2.4 M SODIUM MALONATE PH 5.0
Resolution 1.35 Å R-free 0.199
5APV Sequence IANKEDKAD inserted between GCN4 adaptors - Structure A9b grey Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain D 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain D 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain E 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain E 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain F 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain F 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 0.2 M SODIUM CITRATE, 0.1 M BIS TRIS PROPANE PH 6.5, 20%(W/V) PEG 3350
Resolution 2.00 Å R-free 0.253
5APV Sequence IANKEDKAD inserted between GCN4 adaptors - Structure A9b grey Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain A 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain B 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain B 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain C 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain C 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 0.2 M SODIUM CITRATE, 0.1 M BIS TRIS PROPANE PH 6.5, 20%(W/V) PEG 3350
Resolution 2.00 Å R-free 0.253
5APW Sequence MATKDD inserted between GCN4 adaptors - Structure T6 Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain A 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain B 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain B 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain C 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain C 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES URE UREA × 1 CL CHLORIDE ION × 1 CA CALCIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions 0.2 M CACL, 0.1 M HEPES PH 7.5, 30 %(W/V) PEG 4000
Resolution 1.60 Å R-free 0.205
5APX Sequence MATKDDIAN inserted between GCN4 adaptors - Structure T9(6) Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain A 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain B 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain B 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain C 250–277（28 aa） Fragment：UNP RESIDUES 250-277,250-281
Chain C 250–281（32 aa） Fragment：UNP RESIDUES 250-277,250-281
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES PO4 PHOSPHATE ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions 0.2 M AMMONIUM PHOSPHATE, 0.1 M TRIS PH 8.5, 50 %(V/V) MPD
Resolution 1.80 Å R-free 0.226
5APY Sequence MATKDDIAN inserted between GCN4 adaptors - Structure T9(9) Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa） Fragment：250-277,250-281
Chain A 250–281（32 aa） Fragment：250-277,250-281
Chain B 250–277（28 aa） Fragment：250-277,250-281
Chain B 250–281（32 aa） Fragment：250-277,250-281
Chain C 250–277（28 aa） Fragment：250-277,250-281
Chain C 250–281（32 aa） Fragment：250-277,250-281
Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES Mutation：YES No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 0.1 M CITRIC ACID PH 5.0, 20 %(V/V) ISOPROPANOL
Resolution 2.00 Å R-free 0.255
5APZ Thermosinus carboxydivorans Nor1 Tcar0761 residues 68-101 and 191-211 fused to GCN4 adaptors Deposited 2015-09-17 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–279（30 aa） Fragment：RESIDUES 250-279,68-101,191-211,250-279
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions 0.1 M TRI-SODIUM CITRATE PH 4.0, 30 %(V/V) MPD
Resolution 1.60 Å R-free 0.213
5IEW NMR Structures Show Unwinding of the GCN4p Coiled Coil Superhelix Accompanying Disruption of Ion Pairs at Acidic pH Deposited 2016-02-25 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–280（31 aa） Fragment：UNP residues 250-280
Chain B 250–280（31 aa） Fragment：UNP residues 250-280
Not recorded No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 6.6；298 K；Ionic strength (raw mmCIF value) 20；Pressure 1
NMR measurement conditions pH 6.6；298 K；Ionic strength (raw mmCIF value) 20；Pressure 1
NMR sample composition 1.5 mM [U-99% 13C; U-99% 15N] GCN4p, 90% H2O/10% D2O | 90% H2O/10% D2O
NMR sample composition 1.5 mM 66%-13C 33%-12C GCN4p, 100% D2O | 100% D2O
Resolution not provided
5IIR NMR Structures Show Unwinding of the GCN4p Coiled Coil Superhelix Accompanying Disruption of Ion Pairs at Acidic pH Deposited 2016-03-01 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–280（31 aa） Fragment：UNP residues 250-280
Chain B 250–280（31 aa） Fragment：UNP residues 250-280
Not recorded No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 4.4；298 K；Ionic strength (raw mmCIF value) 20；Pressure 1
NMR measurement conditions pH 4.6；283 K；Ionic strength (raw mmCIF value) 20；Pressure 1
NMR measurement conditions pH 4.4；298 K；Ionic strength (raw mmCIF value) 20；Pressure 1
NMR sample composition 1.5 mM [U-99% 13C; U-99% 15N] GCN4p, 90% H2O/10% D2O | 90% H2O/10% D2O
NMR sample composition 1.5 mM [U-99% 13C; U-99% 15N] GCN4p, 100% D2O | 100% D2O
NMR sample composition 1.5 mM 66% - 13C 33% - 12C GCN4p, 100% D2O | 100% D2O
Resolution not provided
5IIV GCN4p pH 1.5 Deposited 2016-03-01 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–280（31 aa） Fragment：UNP residues 250-280
Chain B 250–280（31 aa） Fragment：UNP residues 250-280
Not recorded No recorded non-water small molecule SOLUTION NMR
NMR measurement conditions pH 1.5；298 K；Ionic strength (raw mmCIF value) 20；Pressure 1
NMR measurement conditions pH 1.5；298 K；Ionic strength (raw mmCIF value) 20；Pressure 1
NMR sample composition 1.5 mM [U-99% 13C; U-99% 15N] GCN4p, 100% D2O | 100% D2O
NMR sample composition 1.5 mM 66% - 13C 33%- 12C GCN4p, 100% D2O | 100% D2O
NMR sample composition 1.5 mM [U-99% 13C; U-99% 15N] GCN4p, 90% H2O/10% D2O | 90% H2O/10% D2O
Resolution not provided
5KHT Crystal structure of the N-terminal fragment of tropomyosin isoform Tpm1.1 at 1.5 A resolution Deposited 2016-06-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 264–281（18 aa）
Chain C 264–281（18 aa）
Not recorded PEG DI(HYDROXYETHYL)ETHER × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；PEG 8000, Hepes/sodium hydroxide
Resolution 1.50 Å R-free 0.249
5KHT Crystal structure of the N-terminal fragment of tropomyosin isoform Tpm1.1 at 1.5 A resolution Deposited 2016-06-15 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain B 264–281（18 aa）
Chain D 264–281（18 aa）
Not recorded PEG DI(HYDROXYETHYL)ETHER × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；PEG 8000, Hepes/sodium hydroxide
Resolution 1.50 Å R-free 0.249
6E52 Chimeric structure of Saccharomyces cerevisiae GCN4 leucine zipper fused to Staphylococcus aureus AgrC cytoplasmic histidine kinase module (dataset anisotropically truncated by STARANISO) Deposited 2018-07-19 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–274（25 aa）
Chain B 250–274（25 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；295 K；0.1 M Tris pH 8.0 and 2.8 M NaCl
Resolution 1.93 Å R-free 0.268
6E52 Chimeric structure of Saccharomyces cerevisiae GCN4 leucine zipper fused to Staphylococcus aureus AgrC cytoplasmic histidine kinase module (dataset anisotropically truncated by STARANISO) Deposited 2018-07-19 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 250–274（25 aa）
Chain B 250–274（25 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；295 K；0.1 M Tris pH 8.0 and 2.8 M NaCl
Resolution 1.93 Å R-free 0.268
6E95 Chimeric structure of Saccharomyces cerevisiae GCN4 leucine zipper fused to Staphylococcus aureus AgrC cytoplasmic histidine kinase module (dataset isotropically truncated by HKL2000) Deposited 2018-07-31 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–274（25 aa）
Chain B 250–274（25 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；295 K；0.1 M Tris pH 8.0 and 2.8 M NaCl
Resolution 2.25 Å R-free 0.275
6E95 Chimeric structure of Saccharomyces cerevisiae GCN4 leucine zipper fused to Staphylococcus aureus AgrC cytoplasmic histidine kinase module (dataset isotropically truncated by HKL2000) Deposited 2018-07-31 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Homooligomer；Protein × 4 PDB declaration: tetrameric
Chain A 250–274（25 aa）
Chain B 250–274（25 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；295 K；0.1 M Tris pH 8.0 and 2.8 M NaCl
Resolution 2.25 Å R-free 0.275
6H9M Coiled-coil domain-containing protein 90B residues 43-125 from Homo sapiens fused to a GCN4 adaptor Deposited 2018-08-04 Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 251–281（31 aa）
Chain B 251–281（31 aa）
Chain C 251–281（31 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；294 K；Molecular Dimensions Morpheus Screen, Well F2
Resolution 2.10 Å R-free 0.257
6HN4 Leucine-zippered human insulin receptor ectodomain with single bound insulin - "lower" membrane-proximal part Deposited 2018-09-14 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain E 249–281（33 aa）
Chain F 249–281（33 aa）
Not recorded NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 6 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.5
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 4.20 Å
6HN5 Leucine-zippered human insulin receptor ectodomain with single bound insulin - "upper" membrane-distal part Deposited 2018-09-14 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 4 PDB declaration: tetrameric
Chain E 249–281（33 aa）
Chain F 249–281（33 aa）
Not recorded NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 9 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.5
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.20 Å
6O2E GCN4 with asparagine at position 18 Deposited 2019-02-22 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–279（31 aa）
Mutation：H266N Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；Pact premier C1
Resolution 1.90 Å R-free 0.247
6O2F GCN4 with NPEG4 at position 18 Deposited 2019-02-22 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–279（31 aa）
Mutation：H266N Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；Pact Premier B1
Resolution 1.80 Å R-free 0.235
6PSA PIE12 D-PEPTIDE AGAINST HIV ENTRY (IN COMPLEX WITH IQN17 Q577R RESISTANCE MUTANT) Deposited 2019-07-12 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 249–276（28 aa） Fragment：GP41 HYDROPHOBIC POCKET, RESIDUES 565-581, GCN4, RESIDUES 249-276
Mutation：Q577R Non-standard monomer：Yes (specific site not provided by mmCIF) CL CHLORIDE ION × 6 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 4.6；294 K；HAMPTON RESEARCH SALT RX SCREEN, CONDITION B4 - 1.8M AMMONIUM CITRATE DIBASIC, 0.1 M SODIUM ACETATE TRIHYDRATE, PH 4.6
Resolution 1.30 Å R-free 0.217
6VWG Head region of the open conformation of the human type 1 insulin-like growth factor receptor ectodomain in complex with human insulin-like growth factor II. Deposited 2020-02-19 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Not recorded NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 4 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.5
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.21 Å
6VWH Leg region of the open conformation of the human type 1 insulin-like growth factor receptor ectodomain in complex with human insulin-like growth factor II. Deposited 2020-02-19 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Not recorded No recorded non-water small molecule ELECTRON MICROSCOPY
cryo-EM buffer pH 7.5
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 4.26 Å
6VWI Head region of the closed conformation of the human type 1 insulin-like growth factor receptor ectodomain in complex with human insulin-like growth factor II. Deposited 2020-02-19 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 3 PDB declaration: trimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Not recorded NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 4 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.5
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.70 Å
6VWJ Leg region of the closed conformation of the human type 1 insulin-like growth factor receptor ectodomain in complex with human insulin-like growth factor II Deposited 2020-02-19 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa）
Chain B 249–281（33 aa）
Not recorded No recorded non-water small molecule ELECTRON MICROSCOPY
cryo-EM buffer pH 7.5
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 4.21 Å
6XNE GCN4-p1 Peptide Trimer with p-methylphenylalanine residue at position 16 (me-F16) Deposited 2020-07-02 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–278（30 aa）
Chain B 249–278（30 aa）
Chain C 249–278（30 aa）
Mutation：me-F16 Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16A Mutation：N16A NA SODIUM ION × 6 MG MAGNESIUM ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；Crystallization drops were prepared by mixing 2 uL of stock peptide solution with 2 uL of mother liquor and allowed to equilibrate at 298 K over a well containing 500 uL of mother liquor. The stock peptide solution (total concentration 1.5 mM) was prepared by mixing 2:1 ratios of the A16 peptide with me-F16 in 10 mM potassium phosphate, 100 mM potassium chloride pH 7.0.
Resolution 1.96 Å R-free 0.309
6XNF GCN4-p1 Peptide Trimer with Tetrafluoroiodophenylalanine residue at position 16 (TFI-F16) Deposited 2020-07-02 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–278（30 aa）
Chain B 249–278（30 aa）
Chain C 249–278（30 aa）
Mutation：TFI-F16 Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：TFI-F16 Mutation：TFI-F16 NA SODIUM ION × 4 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；Crystallization drops were prepared by mixing 2 uL of stock peptide solution with 2 uL of mother liquor and allowed to equilibrate at 298 K over a well containing 500 uL of mother liquor. The stock peptide solution (total concentration 1.5 mM) was prepared by mixing 2:1 ratios of the A16 peptide with TFI-F16 in 10 mM potassium phosphate, 100 mM potassium chloride pH 7.0.
Resolution 2.00 Å R-free 0.254
6XNL GCN4-p1 Peptide Trimer with iodo-phenylalanine residue at position 16 (IPF-F16) Deposited 2020-07-03 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–278（30 aa）
Chain B 249–278（30 aa）
Chain C 249–278（30 aa）
Mutation：IPF-F16 Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：N16A Mutation：N16A NA SODIUM ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；Crystallization drops were prepared by mixing 2 uL of stock peptide solution with 2 uL of mother liquor and allowed to equilibrate at 298 K over a well containing 500 uL of mother liquor. The stock peptide solution (total concentration 1.5 mM) was prepared by mixing 2:1 ratios of the A16 peptide with IPF-F16 in 10 mM potassium phosphate, 100 mM potassium chloride pH 7.0.
Resolution 2.20 Å R-free 0.321
6XNM GCN4-p1 Peptide Trimer with tyrosine residue at position 16 Deposited 2020-07-03 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–278（30 aa）
Chain B 249–278（30 aa）
Chain C 249–278（30 aa）
Mutation：N16A Mutation：N16Y Mutation：N16A NA SODIUM ION × 7 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；Crystallization drops were prepared by mixing 2 uL of stock peptide solution with 2 uL of mother liquor and allowed to equilibrate at 298 K over a well containing 500 uL of mother liquor. The stock peptide solution (total concentration 1.5 mM) was prepared by mixing 2:1 ratios of the A16 peptide with me-F16 in 10 mM potassium phosphate, 100 mM potassium chloride pH 7.0.
Resolution 2.25 Å R-free 0.358
7O9V hypothetical protein OMM_04225 residues 244-274 from Candidatus Magnetoglobus multicellularis fused to GCN4 adaptors Deposited 2021-04-17 Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain B 250–277（28 aa）
Chain C 250–277（28 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；294 K；0.2M KSCN, 0.1M bis tris propane pH 8.5, 20% (w/v) PEG 3350
Resolution 1.99 Å R-free 0.315
7OAA conserved hypothetical protein residues 311-335 from Candidatus Magnetomorum sp. HK-1 fused to GCN4 adaptors Deposited 2021-04-19 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；294 K；0.1M HEPES pH 7.5, 30% (w/v) PEG 300
Resolution 1.40 Å R-free 0.269
7OAC conserved hypothetical protein residues 311-335 from Candidatus Magnetomorum sp. HK-1 fused to GCN4 adaptors, mutant beta1/A, crystal form I Deposited 2021-04-19 Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain B 250–277（28 aa）
Chain C 250–277（28 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；294 K；0.1M tri-sodium citrate pH 4.5, 7.1 % (w/v) PEG 10000
Resolution 2.15 Å R-free 0.258
7OAD conserved hypothetical protein residues 311-335 from Candidatus Magnetomorum sp. HK-1 fused to GCN4 adaptors, mutant beta1/A, crystal form II Deposited 2021-04-19 Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain B 250–277（28 aa）
Chain C 250–277（28 aa）
Not recorded No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；294 K；0.1M tri-sodium citrate pH 4.5, 7.1% PEG 10000
Resolution 2.00 Å R-free 0.294
7OAF conserved hypothetical protein residues 311-335 from Candidatus Magnetomorum sp. HK-1 fused to GCN4 adaptors, mutant beta1/A, crystal form III Deposited 2021-04-19 Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain B 250–277（28 aa）
Chain C 250–277（28 aa）
Not recorded 1PE PENTAETHYLENE GLYCOL × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；294 K；0.1M tri-sodium citrate pH 4.5, 9.3% PEG 6000
Resolution 1.45 Å R-free 0.215
7OAH conserved hypothetical protein residues 311-335 from Candidatus Magnetomorum sp. HK-1 fused to GCN4 adaptors, mutant beta2/A Deposited 2021-04-19 Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 250–277（28 aa）
Chain B 250–277（28 aa）
Chain C 250–277（28 aa）
Not recorded PG4 TETRAETHYLENE GLYCOL × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；294 K；0.1 M tri-sodium citrate pH 5.5, 20% (w/v) PEG 3000
Resolution 1.69 Å R-free 0.268
7SAF Fragment of streptococcal M87 protein fused to GCN4 adaptor Deposited 2021-09-22 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 250–278（29 aa）
Chain B 250–278（29 aa）
Not recorded PO4 PHOSPHATE ION × 2 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.6 M monobasic ammonium phosphate, 0.1 M Tris-HCl, pH 8.0
Resolution 2.45 Å R-free 0.272
7SAY Fragment of streptococcal M87 protein fused to GCN4 adaptor in complex with human cathelicidin Deposited 2021-09-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 3 PDB declaration: trimeric
Chain A 250–278（29 aa）
Chain B 250–278（29 aa）
Not recorded EDO 1,2-ETHANEDIOL × 3 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；10% (v/v) acetonitrile, 0.1 M MES-NaOH, pH 6.5
Resolution 2.10 Å R-free 0.271
7SAY Fragment of streptococcal M87 protein fused to GCN4 adaptor in complex with human cathelicidin Deposited 2021-09-23 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Insufficient information Heteromer；Protein × 3 PDB declaration: trimeric
Chain C 250–278（29 aa）
Chain D 250–278（29 aa）
Not recorded EDO 1,2-ETHANEDIOL × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；10% (v/v) acetonitrile, 0.1 M MES-NaOH, pH 6.5
Resolution 2.10 Å R-free 0.271
8OPM Human Coronavirus HKU1 spike glycoprotein in complex with an alpha2,8-linked 9-O-acetylated disialoside (closed state) Deposited 2023-04-07 Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–278（30 aa）
Chain B 249–278（30 aa）
Chain C 249–278（30 aa）
Not recorded NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 30 ELECTRON MICROSCOPY
cryo-EM buffer pH 8
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.70 Å
8OPN Human Coronavirus HKU1 spike glycoprotein in complex with an alpha2,8-linked 9-O-acetylated disialoside (1-up state) Deposited 2023-04-07 Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–278（30 aa）
Chain B 249–278（30 aa）
Chain C 249–278（30 aa）
Not recorded NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 26 ELECTRON MICROSCOPY
cryo-EM buffer pH 8
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 4.70 Å
8OPO Human Coronavirus HKU1 spike glycoprotein in complex with an alpha2,8-linked 9-O-acetylated disialoside (3-up state) Deposited 2023-04-07 Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Homooligomer；Protein × 3 PDB declaration: trimeric
Chain A 249–278（30 aa）
Chain B 249–278（30 aa）
Chain C 249–278（30 aa）
Not recorded NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 33 ELECTRON MICROSCOPY
cryo-EM buffer pH 8
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.60 Å
9YOP Cryo-EM structure of human beta-cardiac myosin in the interacting-heads motif and S2-FH docked state Deposited 2025-10-13 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Not recorded ADP ADENOSINE-5'-DIPHOSPHATE × 2 PO4 PHOSPHATE ION × 2 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.4
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.50 Å
9YP4 Cryo-EM structure of human beta-cardiac myosin bound to omecamtiv mecarbil in the interacting-heads motif and S2-FH docked state Deposited 2025-10-13 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Not recorded 2OW methyl 4-(2-fluoro-3-{[(6-methylpyridin-3-yl)carbamoyl]amino}benzyl)piperazine-1-carboxylate × 2 ADP ADENOSINE-5'-DIPHOSPHATE × 2 PO4 PHOSPHATE ION × 2 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.4
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 4.50 Å
9YP9 Cryo-EM structure of human beta-cardiac myosin bound to mavacamten in the interacting-heads motif and S2-FH docked state Deposited 2025-10-13 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Not recorded PO4 PHOSPHATE ION × 2 XB2 Mavacamten × 2 ADP ADENOSINE-5'-DIPHOSPHATE × 2 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.4
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.00 Å
9YR7 Cryo-EM structure of human beta-cardiac myosin bound to mavacamten in the interacting-heads motif and S2-FH undocked state Deposited 2025-10-16 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Not recorded XB2 Mavacamten × 2 ADP ADENOSINE-5'-DIPHOSPHATE × 2 PO4 PHOSPHATE ION × 2 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.4
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.00 Å
9YRG Cryo-EM structure of human beta-cardiac myosin in the interacting-heads motif and S2-FH undocked state Deposited 2025-10-16 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Not recorded ADP ADENOSINE-5'-DIPHOSPHATE × 2 PO4 PHOSPHATE ION × 2 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.4
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.20 Å
9YRH Cryo-EM structure of human beta-cardiac myosin bound to omecamtiv mecarbil in the interacting-heads motif and S2-FH undocked state Deposited 2025-10-16 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric
Chain A 250–281（32 aa）
Chain B 250–281（32 aa）
Not recorded 2OW methyl 4-(2-fluoro-3-{[(6-methylpyridin-3-yl)carbamoyl]amino}benzyl)piperazine-1-carboxylate × 2 ADP ADENOSINE-5'-DIPHOSPHATE × 2 PO4 PHOSPHATE ION × 2 ELECTRON MICROSCOPY
cryo-EM buffer pH 7.4
cryo-EM vitrification conditions Cryogen ETHANE
Resolution 3.80 Å
9Z1P Backbone Modification in the GCN4 Leucine Zipper: Prototype Deposited 2025-11-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：leucine zipper domain
Chain B 249–281（33 aa） Fragment：leucine zipper domain
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；298 K；0.2 M sodium acetate pH 4.5, 0.1 M sodium citrate pH 5.6, 10% w/v PEG 3350
Resolution 1.60 Å R-free 0.230
9Z1Q Backbone Modification in the GCN4 Leucine Zipper: Calpha-methyl-Glu at position 11 Deposited 2025-11-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：leucine zipper domain
Chain B 249–281（33 aa） Fragment：leucine zipper domain
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.3 M sodium acetate pH 4.6, 0.1 M sodium citrate pH 4.6, 5% w/v PEG 3350
Resolution 1.80 Å R-free 0.196
9Z1R Backbone Modification in the GCN4 Leucine Zipper: beta3-Glu at position 20 Deposited 2025-11-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：leucine zipper domain
Chain B 249–281（33 aa） Fragment：leucine zipper domain
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.3 M sodium acetate pH 4.6, 0.1 M sodium citrate pH 4.6, 5% w/v PEG 3350
Resolution 1.90 Å R-free 0.214
9Z1R Backbone Modification in the GCN4 Leucine Zipper: beta3-Glu at position 20 Deposited 2025-11-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain C 249–281（33 aa） Fragment：leucine zipper domain
Chain D 249–281（33 aa） Fragment：leucine zipper domain
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.3 M sodium acetate pH 4.6, 0.1 M sodium citrate pH 4.6, 5% w/v PEG 3350
Resolution 1.90 Å R-free 0.214
9Z1S Backbone Modification in the GCN4 Leucine Zipper: beta3-Ala at position 24 Deposited 2025-11-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：leucine zipper domain
Chain B 249–281（33 aa） Fragment：leucine zipper domain
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) GOL GLYCEROL × 1 ACT ACETATE ION × 1 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.2 M sodium acetate pH 4.6, 0.1 M sodium citrate pH 4.6, 10% w/v PEG 3350
Resolution 1.75 Å R-free 0.233
9Z1T Backbone Modification in the GCN4 Leucine Zipper: Aib at position 24 Deposited 2025-11-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：leucine zipper domain
Chain B 249–281（33 aa） Fragment：leucine zipper domain
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.2 M sodium acetate pH 4.6, 0.1 M sodium citrate pH 4.6, 10% w/v PEG 3350
Resolution 1.60 Å R-free 0.216
9Z1U Backbone Modification in the GCN4 Leucine Zipper: beta3-Lys at position 28 Deposited 2025-11-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：leucine zipper domain
Chain B 249–281（33 aa） Fragment：leucine zipper domain
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.2 M sodium acetate pH 4.6, 0.1 M sodium citrate pH 4.6, 10% w/v PEG 3350
Resolution 1.50 Å R-free 0.206
9Z1V Backbone Modification in the GCN4 Leucine Zipper: Calpha-methyl-Lys at position 28 Deposited 2025-11-04 Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric
Chain A 249–281（33 aa） Fragment：leucine zipper domain
Chain B 249–281（33 aa） Fragment：leucine zipper domain
Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) No recorded non-water small molecule X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；298 K；0.2 M sodium acetate pH 4.6, 0.1 M sodium citrate pH 4.6, 15% w/v PEG 3350
Resolution 1.65 Å R-free 0.211
9Z4E Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT and loaded with mutated Bzip region of GCN4 transcription factor Deposited 2025-11-10 Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric
Chain D 226–253（28 aa） Fragment：Bzip region
Chain E 226–253（28 aa） Fragment：Bzip region
Chain F 226–253（28 aa） Fragment：Bzip region
Mutation：residues 251-253 (Uniprot numbering) mutated from KQL to KKQC Mutation：residues 251-253 (Uniprot numbering) mutated from KQL to KKQC Mutation：residues 251-253 (Uniprot numbering) mutated from KQL to KKQC MG MAGNESIUM ION × 3 X-RAY DIFFRACTION
X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；50mM magnesium acetate, 1.6M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 47.5 mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 100 micromolar bZip
Resolution 3.63 Å R-free 0.285

162 other PDB entries and 200 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence
UniProt name GCN4_YEAST
Isoform —
PDB entities 4
Chains and sequence ranges Author chain D； PDBConstruct 1–26； UniProt 226–251 Author chain E； PDBConstruct 1–26； UniProt 226–251 Author chain F； PDBConstruct 1–26； UniProt 226–251

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

SAXS profile for 9yzu

P(r) Distance Distribution P(r) Distribution

P(r) distribution for 9yzu
Download Download
▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id9yzu
Deposition date deposition_date2025-10-30
最后修订 last_revision2026-02-18
Structure title titleIsoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor
Keywords keywordsProtein-DNA complex, DNA Binding protein, Transcription factor, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method methodX-RAY DIFFRACTION
▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier29.70 Å
Radius of gyration Rg (electron density) rg_electron29.01 Å
Forward intensity I(0) i063985600.00
Molecular weight molecular_weight49673.0 kDa
Excluded volume excluded_volume56456 ų
Envelope volume envelope_volume79129 ų
Hydration-shell volume shell_volume25089 ų
Envelope diameter envelope_diameter106.5 Å
Shell Rg shell_rg32.82 Å
Envelope Rg envelope_rg29.40 Å
Shape Rg shape_rg28.94 Å
Total Rg total_rg29.50 Å
Total atoms total_atoms3421
Residues n_residues340
Spherical-harmonic order n_harmonics20
q range q_range— – 0.5000 Å−1
Data points n_points101
Shell type shell_typedirectional
Solvent electron density solvent_density0.3340 e/ų
Shell contrast contrast_shell0.0300 e/ų
CRYSOL version crysol_version4.1.3
▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax102.4 Å
Rg (real space) rg_real30.05 Å
Rg uncertainty (real space) rg_real_error1.26 Å
I(0) (real space) i0_real6.3990e+07
I(0) uncertainty (real space) i0_real_error1.0890e+06
Rg (reciprocal space) rg_reciprocal29.90 Å
I(0) (reciprocal space) i0_reciprocal63980000.0000
Solution quality estimate total_estimate0.8144
Solution quality rating solution_quality GOOD a GOOD solution
P(r) peaks n_peaks2
Primary peak position r_peak_primary27.0 Å
Skewness Skewness skewness0.582
Kurtosis Kurtosis kurtosis-0.253
Angular range angular_range— – 0.2650 Å−1
Current regularization parameter α current_alpha0.0000
Highest regularization parameter α highest_alpha4663000.0000
Real-space data points n_real_points54
GNOM version gnom_version4.1.3
Quality Criteria quality_criteria AN1: 0.000; Oscil: 0.741; Stabil: 0.997; Sysdev: 1.000; Positv: 1.000; Valcen: 0.627; Smooth: 0.744
▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

▶

8. Citations (1)

▶

9. Files and Curves (10)