SAXSdb — 1asz

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ASPARTYL-tRNA SYNTHETASE

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Homooligomer Protein × 2 RNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 67–556 Chain B； UniProt 67–556	Not recorded	T-RNA (75-MER) × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 2	X-RAY DIFFRACTION mmCIF provides none of the parsed experimental conditions	Resolution 3.00 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1ASZ	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1ASY CLASS II AMINOACYL TRANSFER RNA SYNTHETASES: CRYSTAL STRUCTURE OF YEAST ASPARTYL-TRNA SYNTHETASE COMPLEXED WITH TRNA ASP Deposited 1995-01-19	Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 67–556（490 aa） Chain B 67–556（490 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.90 Å
1EOV FREE ASPARTYL-TRNA SYNTHETASE (ASPRS) (E.C. 6.1.1.12) FROM YEAST Deposited 2000-03-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 70–556（487 aa） Fragment：ENGINEERED ASPRS MONOMER LACKING THE 70 N-TERMINAL AMINO ACID RESIDUES	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.6；278 K；15 MG/ML PROTEIN, 1.9 M AMMONIUM SULFATE, pH 5.60, VAPOR DIFFUSION, SITTING DROP, temperature 278.0K	Resolution 2.30 Å R-free 0.242

2 other PDB entries and 2 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	SYDC_YEAST
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–490； UniProt 67–556 Author chain B； PDBConstruct 1–490； UniProt 67–556

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1asz
Deposition date deposition_date	1995-01-19
Structure title title	THE ACTIVE SITE OF YEAST ASPARTYL-TRNA SYNTHETASE: STRUCTURAL AND FUNCTIONAL ASPECTS OF THE AMINOACYLATION REACTION
Keywords keywords	COMPLEX (AMINOACYL-TRNA SYNTHASE-TRNA), COMPLEX (AMINOACYL-TRNA SYNTHASE-TRNA) complex; COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA)
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	38.54 Å
Radius of gyration Rg (electron density) rg_electron	36.41 Å
Forward intensity I(0) i0	582426000.00
Molecular weight molecular_weight	161530.0 kDa
Excluded volume excluded_volume	187020 Å³
Envelope volume envelope_volume	246030 Å³
Hydration-shell volume shell_volume	56242 Å³
Envelope diameter envelope_diameter	125.8 Å
Shell Rg shell_rg	42.81 Å
Envelope Rg envelope_rg	36.51 Å
Shape Rg shape_rg	36.26 Å
Total Rg total_rg	37.09 Å
Total atoms total_atoms	11158
Residues n_residues	1114
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	129.2 Å
Rg (real space) rg_real	38.57 Å
Rg uncertainty (real space) rg_real_error	1.52 Å
I(0) (real space) i0_real	5.8240e+08
I(0) uncertainty (real space) i0_real_error	1.1650e+07
Rg (reciprocal space) rg_reciprocal	38.56 Å
I(0) (reciprocal space) i0_reciprocal	582400000.0000
Solution quality estimate total_estimate	0.8104
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	47.2 Å
Skewness Skewness skewness	0.345
Kurtosis Kurtosis kurtosis	-0.386
Angular range angular_range	— – 0.2050 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	41750000.0000
Real-space data points n_real_points	42
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.855; Stabil: 0.990; Sysdev: 1.000; Positv: 1.000; Valcen: 0.995; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	T-RNA (75-MER)
Molecular weight formula_weight	24181.4 kDa
EC 编号 ec_number	6.1.1.12
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R,S
Atom count atom_count	11158

UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAGCCA

Entity 2 Entity 2 polymer

Description description	ASPARTYL-tRNA SYNTHETASE
Molecular weight formula_weight	56026.8 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

EDTAKDNYGKLPLIQSRDSDRTGQKRVKFVDLDEAKDSDKEVLFRARVHNTRQQGATLAFLTLRQQASLIQGLVKANKEGTISKNMVKWAGSLNLESIVLVRGIVKKVDEPIKSATVQNLEIHITKIYTISETPEALPILLEDASRSEAEAEAAGLPVVNLDTRLDYRVIDLRTVTNQAIFRIQAGVCELFREYLATKKFTEVHTPKLLGAPSEGGSSVFEVTYFKGKAYLAQSPQFNKQQLIVADFERVYEIGPVFRAENSNTHRHMTEFTGLDMEMAFEEHYHEVLDTLSELFVFIFSELPKRFAHEIELVRKQYPVEEFKLPKDGKMVRLTYKEGIEMLRAAGKEIGDFEDLSTENEKFLGKLVRDKYDTDFYILDKFPLEIRPFYTMPDPANPKYSNSYDFFMRGEEILSGAQRIHDHALLQERMKAHGLSPEDPGLKDYCDGFSYGCPPHAGGGIGLERVVMFYLDLKNIRRASLFPRDPKRLRP

来源 Source

来源生物 organism

Saccharomyces cerevisiae

Entity 3 Entity 3 non-polymer

Description description	ADENOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	507.2 kDa
Source method src_method	syn
Copy count entity_count	2

▼

7. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d1asza1
Class class	b — All beta proteins
Fold Fold fold	b.40 — OB-fold
Superfamily Superfamily superfamily	b.40.4 — Nucleic acid-binding proteins
Family Family family	b.40.4.1 — Anticodon-binding domain

Domain ID domain_id	d1asza2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.104 — Class II aaRS and biotin synthetases
Superfamily Superfamily superfamily	d.104.1 — Class II aaRS and biotin synthetases
Family Family family	d.104.1.1 — Class II aminoacyl-tRNA synthetase (aaRS)-like, catalytic domain

Domain ID domain_id	d1aszb1
Class class	b — All beta proteins
Fold Fold fold	b.40 — OB-fold
Superfamily Superfamily superfamily	b.40.4 — Nucleic acid-binding proteins
Family Family family	b.40.4.1 — Anticodon-binding domain

Domain ID domain_id	d1aszb2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.104 — Class II aaRS and biotin synthetases
Superfamily Superfamily superfamily	d.104.1 — Class II aaRS and biotin synthetases
Family Family family	d.104.1.1 — Class II aminoacyl-tRNA synthetase (aaRS)-like, catalytic domain

CATH v4.4 (4 domains)

Domain ID domain_id	1aszA01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

Domain ID domain_id	1aszA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	1aszB01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

Domain ID domain_id	1aszB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

▶

8. Citations (4)

▶

Unit-cell length a length_a	211.270 Å
Unit-cell length b length_b	145.350 Å
Unit-cell length c length_c	86.190 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	3.000 Å
Low-resolution limit resolution_low	7.000 Å
R factor r_factor	0.2030
R_work r_work	0.2030
R_free r_free	—

fit	/app/data/saxs_computation/as/1asz/1asz.fit
pddf	/app/data/pr_computation/as/1asz/1asz.pr.out
profile	/app/data/saxs_computation/as/1asz/1asz.dat

THE ACTIVE SITE OF YEAST ASPARTYL-TRNA SYNTHETASE: STRUCTURAL AND FUNCTIONAL ASPECTS OF THE AMINOACYLATION REACTION

1. Protein Identity and Related Structures Protein Identity & Related Structures

ASPARTYL-tRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

7. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

8. Citations (4)

9. Files and Curves (10)

Files (7)

Curves (3)