1ob5

T. aquaticus elongation factor EF-Tu complexed with the antibiotic enacyloxin IIa, a GTP analog, and Phe-tRNA

Method: X-RAY DIFFRACTION D_max: 138.5 Å Quality: EXCELLENT

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ELONGATION FACTOR TU

THERMUS AQUATICUS

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Homooligomer Protein × 3 RNA 3 PDB declaration: hexameric（6） Consistent with all polymer counts	Chain A； UniProt 1–405 Chain C； UniProt 1–405 Chain E； UniProt 1–405	Not recorded	TRANSFER-RNA, PHE × 3 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 3 MG MAGNESIUM ION × 3 ENX ENACYLOXIN IIA × 3	X-RAY DIFFRACTION X-ray crystallization conditions：pH 6.8；1.8M AMMONIUM SULPHATE, 10 MM MAGNESIUM CHLORIDE,20 MM TRIS-MES, PH 6.4	Resolution 3.10 Å R-free 0.294

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1OB5	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1B23 E. coli cysteinyl-tRNA and T. aquaticus elongation factor EF-TU:GTP ternary complex Deposited 1998-12-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain P 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 3 CYS CYSTEINE × 1 SO4 SULFATE ION × 2 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.7；277 K；2.1 M (NH4)2SO4, 30 MM TRIS, 5 MM MES, 10 MM MGCL2, 10 MM DTT, 1 MM GDPNP PH 6.7, 4 DEG. C, HANGING DROP, vapor diffusion - hanging drop, temperature 277K	Resolution 2.60 Å R-free 0.263
1EFT THE CRYSTAL STRUCTURE OF ELONGATION FACTOR EF-TU FROM THERMUS AQUATICUS IN THE GTP CONFORMATION Deposited 1993-08-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 1 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.50 Å
1TTT Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex Deposited 1995-11-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 2 PHE PHENYLALANINE × 1 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 6.8；pH 6.8	Resolution 2.70 Å R-free 0.290
1TTT Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex Deposited 1995-11-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain B 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 2 PHE PHENYLALANINE × 1 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 6.8；pH 6.8	Resolution 2.70 Å R-free 0.290
1TTT Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex Deposited 1995-11-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain C 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 2 PHE PHENYLALANINE × 1 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 6.8；pH 6.8	Resolution 2.70 Å R-free 0.290
1TUI INTACT ELONGATION FACTOR TU IN COMPLEX WITH GDP Deposited 1996-05-23	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 1–405（405 aa） Chain B 1–405（405 aa） Chain C 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 3 GDP GUANOSINE-5'-DIPHOSPHATE × 3	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.70 Å R-free 0.300

4 other PDB entries and 6 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	EFTU_THEAQ
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–405； UniProt 1–405 Author chain C； PDBConstruct 1–405； UniProt 1–405 Author chain E； PDBConstruct 1–405； UniProt 1–405

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1ob5
Deposition date deposition_date	2003-01-24
Structure title title	T. aquaticus elongation factor EF-Tu complexed with the antibiotic enacyloxin IIa, a GTP analog, and Phe-tRNA
Keywords keywords	HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA, GTP-BINDING, NUCLEOTIDE-BINDING, PROTEIN BIOSYNTHESIS; HYDROLASE
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	43.99 Å
Radius of gyration Rg (electron density) rg_electron	45.26 Å
Forward intensity I(0) i0	1044870000.00
Molecular weight molecular_weight	211690.0 kDa
Excluded volume excluded_volume	241510 Å³
Envelope volume envelope_volume	352490 Å³
Hydration-shell volume shell_volume	66156 Å³
Envelope diameter envelope_diameter	140.6 Å
Shell Rg shell_rg	49.67 Å
Envelope Rg envelope_rg	43.07 Å
Shape Rg shape_rg	45.33 Å
Total Rg total_rg	45.24 Å
Total atoms total_atoms	14547
Residues n_residues	1383
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	138.5 Å
Rg (real space) rg_real	43.80 Å
Rg uncertainty (real space) rg_real_error	1.01 Å
I(0) (real space) i0_real	1.0450e+09
I(0) uncertainty (real space) i0_real_error	1.9040e+07
Rg (reciprocal space) rg_reciprocal	43.99 Å
I(0) (reciprocal space) i0_reciprocal	1045000000.0000
Solution quality estimate total_estimate	0.9050
Solution quality rating solution_quality	EXCELLENT a EXCELLENT solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	57.7 Å
Skewness Skewness skewness	0.077
Kurtosis Kurtosis kurtosis	-0.635
Angular range angular_range	— – 0.1800 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	47680000.0000
Real-space data points n_real_points	37
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.944; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.998; Smooth: 0.929

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	ELONGATION FACTOR TU
Molecular weight formula_weight	44743.0 kDa
EC 编号 ec_number	3.6.1.48
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C,E
Atom count atom_count	14547

AKGEFIRTKPHVNVGTIGHVDHGKTTLTAALTYVAAAENPNVEVKDYGDIDKAPEERARGITINTAHVEYETAKRHYSHVDCPGHADYIKNMITGAAQMDGAILVVSAADGPMPQTREHILLARQVGVPYIVVFMNKVDMVDDPELLDLVEMEVRDLLNQYEFPGDEVPVIRGSALLALEEMHKNPKTKRGENEWVDKIWELLDAIDEYIPTPVRDVDKPFLMPVEDVFTITGRGTVATGRIERGKVKVGDEVEIVGLAPETRKTVVTGVEMHRKTLQEGIAGDNVGLLLRGVSREEVERGQVLAKPGSITPHTKFEASVYILKKEEGGRHTGFFTGYRPQFYFRTTDVTGVVRLPQGVEMVMPGDNVTFTVELIKPVALEEGLRFAIREGGRTVGAGVVTKILE

来源 Source

来源生物 organism	THERMUS AQUATICUS
NCBI Class编号 ncbi_taxonomy_id	271
宿主生物 host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	TRANSFER-RNA, PHE
Molecular weight formula_weight	25326.5 kDa
Source method src_method	nat
Copy count entity_count	3

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,D,F

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCAFC

Entity 3 Entity 3 non-polymer

Description description	PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER
Molecular weight formula_weight	522.2 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 non-polymer

Description description	ENACYLOXIN IIA
Molecular weight formula_weight	702.6 kDa
Source method src_method	syn
Copy count entity_count	3

▼

7. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (9 domains)

Domain ID domain_id	d1ob5a1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.0 — automated matches

Domain ID domain_id	d1ob5a2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.0 — automated matches

Domain ID domain_id	d1ob5a3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

Domain ID domain_id	d1ob5c1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.0 — automated matches

Domain ID domain_id	d1ob5c2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.0 — automated matches

Domain ID domain_id	d1ob5c3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

Domain ID domain_id	d1ob5e1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.0 — automated matches

Domain ID domain_id	d1ob5e2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.0 — automated matches

Domain ID domain_id	d1ob5e3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

CATH v4.4 (9 domains)

Domain ID domain_id	1ob5A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1ob5A02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5A03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5C01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1ob5C02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5C03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5E01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1ob5E02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5E03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

▶

8. Citations (1)

▶

Unit-cell length a length_a	212.570 Å
Unit-cell length b length_b	122.330 Å
Unit-cell length c length_c	135.680 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	121.30 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	29.540 Å
R factor r_factor	0.2796
R_work r_work	0.2796
R_free r_free	0.2940

fit	/app/data/saxs_computation/ob/1ob5/1ob5.fit
pddf	/app/data/pr_computation/ob/1ob5/1ob5.pr.out
profile	/app/data/saxs_computation/ob/1ob5/1ob5.dat

T. aquaticus elongation factor EF-Tu complexed with the antibiotic enacyloxin IIa, a GTP analog, and Phe-tRNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

ELONGATION FACTOR TU

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

7. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (9 domains)

CATH v4.4 (9 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)