1ob5

T. aquaticus elongation factor EF-Tu complexed with the antibiotic enacyloxin IIa, a GTP analog, and Phe-tRNA

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ELONGATION FACTOR TU

THERMUS AQUATICUS

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 3 RNA 3	TRANSFER-RNA, PHE × 3 PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 3 MAGNESIUM ION × 3 ENACYLOXIN IIA × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	EFTU_THEAQ
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–405； UniProt 1–405 Author chain C； PDBConstruct 1–405； UniProt 1–405 Author chain E； PDBConstruct 1–405； UniProt 1–405

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1ob5
Deposition date deposition_date	2003-01-24
Structure title title	T. aquaticus elongation factor EF-Tu complexed with the antibiotic enacyloxin IIa, a GTP analog, and Phe-tRNA
Keywords keywords	HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA, GTP-BINDING, NUCLEOTIDE-BINDING, PROTEIN BIOSYNTHESIS; HYDROLASE
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1ob5__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1ob5__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1ob5__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	43.99 Å
Rg (electron density)	45.26 Å
Total Rg	45.24 Å
Atom count	14547
Residues	1386
Excluded volume	241510 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1ob5__assembly_1__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	ELONGATION FACTOR TU
Molecular weight formula_weight	44743.0 kDa
EC 编号 ec_number	3.6.1.48
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C,E
Atom count atom_count	14547

AKGEFIRTKPHVNVGTIGHVDHGKTTLTAALTYVAAAENPNVEVKDYGDIDKAPEERARGITINTAHVEYETAKRHYSHVDCPGHADYIKNMITGAAQMDGAILVVSAADGPMPQTREHILLARQVGVPYIVVFMNKVDMVDDPELLDLVEMEVRDLLNQYEFPGDEVPVIRGSALLALEEMHKNPKTKRGENEWVDKIWELLDAIDEYIPTPVRDVDKPFLMPVEDVFTITGRGTVATGRIERGKVKVGDEVEIVGLAPETRKTVVTGVEMHRKTLQEGIAGDNVGLLLRGVSREEVERGQVLAKPGSITPHTKFEASVYILKKEEGGRHTGFFTGYRPQFYFRTTDVTGVVRLPQGVEMVMPGDNVTFTVELIKPVALEEGLRFAIREGGRTVGAGVVTKILE

Source Source

Source organism organism	THERMUS AQUATICUS
NCBI taxonomy ID ncbi_taxonomy_id	271
Host organism host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	TRANSFER-RNA, PHE
Molecular weight formula_weight	25326.5 kDa
Source method src_method	nat
Copy count entity_count	3

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,D,F

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCAFC

Entity 3 Entity 3 non-polymer

Description description	PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER
Molecular weight formula_weight	522.2 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 non-polymer

Description description	ENACYLOXIN IIA
Molecular weight formula_weight	702.6 kDa
Source method src_method	syn
Copy count entity_count	3

▼

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (9 domains)

Domain ID domain_id	d1ob5a1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.0 — automated matches

Domain ID domain_id	d1ob5a2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.0 — automated matches

Domain ID domain_id	d1ob5a3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

Domain ID domain_id	d1ob5c1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.0 — automated matches

Domain ID domain_id	d1ob5c2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.0 — automated matches

Domain ID domain_id	d1ob5c3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

Domain ID domain_id	d1ob5e1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.0 — automated matches

Domain ID domain_id	d1ob5e2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.0 — automated matches

Domain ID domain_id	d1ob5e3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

CATH v4.4 (9 domains)

Domain ID domain_id	1ob5A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1ob5A02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5A03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5C01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1ob5C02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5C03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5E01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1ob5E02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1ob5E03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

▶

Unit-cell length a length_a	212.570 Å
Unit-cell length b length_b	122.330 Å
Unit-cell length c length_c	135.680 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	121.30 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	29.540 Å
R factor r_factor	0.2796
R_work r_work	0.2796
R_free r_free	0.2940

T. aquaticus elongation factor EF-Tu complexed with the antibiotic enacyloxin IIa, a GTP analog, and Phe-tRNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

ELONGATION FACTOR TU

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1ob5__assembly_1__model_1

1ob5__assembly_1__model_1 | I(q)

1ob5__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (9 domains)

CATH v4.4 (9 domains)

7. Citations (1)

T. aquaticus elongation factor EF-Tu complexed with the antibiotic enacyloxin IIa, a GTP analog, and Phe-tRNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

ELONGATION FACTOR TU

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1ob5__assembly_1__model_1

1ob5__assembly_1__model_1 | I(q)

1ob5__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (9 domains)

CATH v4.4 (9 domains)

7. Citations (1)