1ttt

Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex

Method: X-RAY DIFFRACTION D_max: 126.6 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

OF ELONGATION FACTOR TU (EF-TU)

OrganismNot specified

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 1–405	Not recorded	TRANSFER RIBONUCLEIC ACID (YEAST, PHE) × 1 MG MAGNESIUM ION × 2 PHE PHENYLALANINE × 1 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions：pH 6.8；pH 6.8	Resolution 2.70 Å R-free 0.290
2	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain B； UniProt 1–405	Not recorded	TRANSFER RIBONUCLEIC ACID (YEAST, PHE) × 1 MG MAGNESIUM ION × 2 PHE PHENYLALANINE × 1 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions：pH 6.8；pH 6.8	Resolution 2.70 Å R-free 0.290
3	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain C； UniProt 1–405	Not recorded	TRANSFER RIBONUCLEIC ACID (YEAST, PHE) × 1 MG MAGNESIUM ION × 2 PHE PHENYLALANINE × 1 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions：pH 6.8；pH 6.8	Resolution 2.70 Å R-free 0.290

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1TTT	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1B23 E. coli cysteinyl-tRNA and T. aquaticus elongation factor EF-TU:GTP ternary complex Deposited 1998-12-04	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain P 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 3 CYS CYSTEINE × 1 SO4 SULFATE ION × 2 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.7；277 K；2.1 M (NH4)2SO4, 30 MM TRIS, 5 MM MES, 10 MM MGCL2, 10 MM DTT, 1 MM GDPNP PH 6.7, 4 DEG. C, HANGING DROP, vapor diffusion - hanging drop, temperature 277K	Resolution 2.60 Å R-free 0.263
1EFT THE CRYSTAL STRUCTURE OF ELONGATION FACTOR EF-TU FROM THERMUS AQUATICUS IN THE GTP CONFORMATION Deposited 1993-08-24	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 1 GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.50 Å
1OB5 T. aquaticus elongation factor EF-Tu complexed with the antibiotic enacyloxin IIa, a GTP analog, and Phe-tRNA Deposited 2003-01-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 3 PDB declaration: hexameric	Chain A 1–405（405 aa） Chain C 1–405（405 aa） Chain E 1–405（405 aa）	Not recorded	GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 3 MG MAGNESIUM ION × 3 ENX ENACYLOXIN IIA × 3	X-RAY DIFFRACTION X-ray crystallization conditions pH 6.8；1.8M AMMONIUM SULPHATE, 10 MM MAGNESIUM CHLORIDE,20 MM TRIS-MES, PH 6.4	Resolution 3.10 Å R-free 0.294
1TUI INTACT ELONGATION FACTOR TU IN COMPLEX WITH GDP Deposited 1996-05-23	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 1–405（405 aa） Chain B 1–405（405 aa） Chain C 1–405（405 aa）	Not recorded	MG MAGNESIUM ION × 3 GDP GUANOSINE-5'-DIPHOSPHATE × 3	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.70 Å R-free 0.300

4 other PDB entries and 4 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	EFTU_THEAQ
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–405； UniProt 1–405 Author chain B； PDBConstruct 1–405； UniProt 1–405 Author chain C； PDBConstruct 1–405； UniProt 1–405

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1ttt
Deposition date deposition_date	1995-11-16
Structure title title	Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex
Keywords keywords	;PROTEIN SYNTHESIS, EF-TU, TRNA, RIBOSOME, 1EFT, 4TNA, PEPTIDE ELONGATION RIBONUCLEOPROTEIN, COMPLEX (ELONGATION FACTOR-TRNA), COMPLEX (ELONGATION FACTOR-TRNA) complex ;; COMPLEX (ELONGATION FACTOR/TRNA)
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	41.23 Å
Radius of gyration Rg (electron density) rg_electron	41.92 Å
Forward intensity I(0) i0	1050910000.00
Molecular weight molecular_weight	211250.0 kDa
Excluded volume excluded_volume	240820 Å³
Envelope volume envelope_volume	338020 Å³
Hydration-shell volume shell_volume	67477 Å³
Envelope diameter envelope_diameter	132.0 Å
Shell Rg shell_rg	47.64 Å
Envelope Rg envelope_rg	40.30 Å
Shape Rg shape_rg	41.97 Å
Total Rg total_rg	42.04 Å
Total atoms total_atoms	14523
Residues n_residues	1401
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	126.6 Å
Rg (real space) rg_real	41.03 Å
Rg uncertainty (real space) rg_real_error	0.93 Å
I(0) (real space) i0_real	1.0510e+09
I(0) uncertainty (real space) i0_real_error	1.9720e+07
Rg (reciprocal space) rg_reciprocal	41.23 Å
I(0) (reciprocal space) i0_reciprocal	1051000000.0000
Solution quality estimate total_estimate	0.8327
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	56.6 Å
Skewness Skewness skewness	0.060
Kurtosis Kurtosis kurtosis	-0.581
Angular range angular_range	— – 0.1900 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	56600000.0000
Real-space data points n_real_points	39
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.945; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.986; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	TRANSFER RIBONUCLEIC ACID (YEAST, PHE)
Molecular weight formula_weight	24890.1 kDa
Source method src_method	syn
Copy count entity_count	3

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	D,E,F
Atom count atom_count	14573

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA

Entity 2 Entity 2 polymer

Description description	OF ELONGATION FACTOR TU (EF-TU)
Molecular weight formula_weight	44743.0 kDa
Source method src_method	nat
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C

AKGEFIRTKPHVNVGTIGHVDHGKTTLTAALTYVAAAENPNVEVKDYGDIDKAPEERARGITINTAHVEYETAKRHYSHVDCPGHADYIKNMITGAAQMDGAILVVSAADGPMPQTREHILLARQVGVPYIVVFMNKVDMVDDPELLDLVEMEVRDLLNQYEFPGDEVPVIRGSALLALEEMHKNPKTKRGENEWVDKIWELLDAIDEYIPTPVRDVDKPFLMPVEDVFTITGRGTVATGRIERGKVKVGDEVEIVGLAPETRKTVVTGVEMHRKTLQEGIAGDNVGLLLRGVSREEVERGQVLAKPGSITPHTKFEASVYILKKEEGGRHTGFFTGYRPQFYFRTTDVTGVVRLPQGVEMVMPGDNVTFTVELIKPVALEEGLRFAIREGGRTVGAGVVTKILE

Entity 3 Entity 3 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	6

Entity 4 Entity 4 non-polymer

Description description	PHENYLALANINE
Molecular weight formula_weight	165.2 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 non-polymer

Description description	PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER
Molecular weight formula_weight	522.2 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	50

▼

7. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (9 domains)

Domain ID domain_id	d1ttta1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.1 — Elongation factors

Domain ID domain_id	d1ttta2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain

Domain ID domain_id	d1ttta3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

Domain ID domain_id	d1tttb1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.1 — Elongation factors

Domain ID domain_id	d1tttb2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain

Domain ID domain_id	d1tttb3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

Domain ID domain_id	d1tttc1
Class class	b — All beta proteins
Fold Fold fold	b.43 — Reductase/isomerase/elongation factor common domain
Superfamily Superfamily superfamily	b.43.3 — Translation proteins
Family Family family	b.43.3.1 — Elongation factors

Domain ID domain_id	d1tttc2
Class class	b — All beta proteins
Fold Fold fold	b.44 — Elongation factor/aminomethyltransferase common domain
Superfamily Superfamily superfamily	b.44.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain
Family Family family	b.44.1.1 — EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain

Domain ID domain_id	d1tttc3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.8 — G proteins

CATH v4.4 (9 domains)

Domain ID domain_id	1tttA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1tttA02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1tttA03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1tttB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1tttB02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1tttB03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1tttC01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1tttC02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

Domain ID domain_id	1tttC03
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	30 — Elongation Factor Tu (Ef-tu); domain 3
Homologous superfamily homologous superfamily	10 — Translation factors

▶

8. Citations (3)

▶

Unit-cell length a length_a	206.835 Å
Unit-cell length b length_b	122.354 Å
Unit-cell length c length_c	151.552 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	126.30 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	2.700 Å
Low-resolution limit resolution_low	25.000 Å
R factor r_factor	—
R_work r_work	0.2060
R_free r_free	0.2900

fit	/app/data/saxs_computation/tt/1ttt/1ttt.fit
pddf	/app/data/pr_computation/tt/1ttt/1ttt.pr.out
profile	/app/data/saxs_computation/tt/1ttt/1ttt.dat

Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

OF ELONGATION FACTOR TU (EF-TU)

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

7. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (9 domains)

CATH v4.4 (9 domains)

8. Citations (3)

9. Files and Curves (10)

Files (7)

Curves (3)