SAXSdb — 2re8

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glutaminyl-tRNA synthetase

Escherichia coli

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	Glutamine tRNA × 1 SULFATE ION × 2 O5'-(L-GLUTAMYL-SULFAMOYL)-ADENOSINE × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYQ_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–548； UniProt 1–548

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2re8
Deposition date deposition_date	2007-09-25
Structure title title	Glutaminyl-tRNA synthetase mutant C229R with bound analog 5'-O-[N-(L-GLUTAMYL)-SULFAMOYL]ADENOSINE
Keywords keywords	;protein-RNA complex, Aminoacyl-tRNA synthetase, ATP-binding, Cytoplasm, Ligase, Nucleotide-binding, Protein biosynthesis, LIGASE-RNA COMPLEX ;; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2re8__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2re8__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2re8__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	30.62 Å
Rg (electron density)	30.74 Å
Total Rg	31.14 Å
Atom count	5896
Residues	603
Excluded volume	98550 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2re8__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Glutamine tRNA
Molecular weight formula_weight	24099.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	6033

GGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA

Entity 2 Entity 2 polymer

Description description	Glutaminyl-tRNA synthetase
Molecular weight formula_weight	64019.3 kDa
EC 编号 ec_number	6.1.1.18
Mutation mutation	C229R
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MSEAEARPTNFIRQIIDEDLASGKHTTVHTRFPPEPNGYLHIGHAKSICLNFGIAQDYKGQCNLRFDDTNPVKEDIEYVESIKNDVEWLGFHWSGNVRYSSDYFDQLHAYAIELINKGLAYVDELTPEQIREYRGTLTQPGKNSPYRDRSVEENLALFEKMRAGGFEEGKACLRAKIDMASPFIVMRDPVLYRIKFAEHHQTGNKWCIYPMYDFTHCISDALEGITHSLRTLEFQDNRRLYDWVLDNITIPVHPRQYEFSRLNLEYTVMSKRKLNLLVTDKHVEGWDDPRMPTISGLRRRGYTAASIREFCKRIGVTKQDNTIEMASLESCIREDLNENAPRAMAVIDPVKLVIENYQGEGEMVTMPNHPNKPEMGSRQVPFSGEIWIDRADFREEANKQYKRLVLGKEVRLRNAYVIKAERVEKDAEGNITTIFCTYDADTLSKDPADGRKVKGVIHWVSAAHALPVEIRLYDRLFSVPNPGAADDFLSVINPESLVIKQGFAEPSLKDAVAGKAFQFEREGYFCLDSRHSTAEKPVFNRTVGLRDTLEHHHHHH

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	O5'-(L-GLUTAMYL-SULFAMOYL)-ADENOSINE
Molecular weight formula_weight	475.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	137

▼

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (2 domains)

Domain ID domain_id	d2re8a1
Class class	b — All beta proteins
Fold Fold fold	b.53 — Ribosomal protein L25-like
Superfamily Superfamily superfamily	b.53.1 — Ribosomal protein L25-like
Family Family family	b.53.1.2 — Gln-tRNA synthetase (GlnRS), C-terminal (anticodon-binding) domain

Domain ID domain_id	d2re8a2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

CATH v4.4 (5 domains)

Domain ID domain_id	2re8A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	2re8A02
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	800 — Glutamyl-tRNA Synthetase; domain 3
Homologous superfamily homologous superfamily	10 — Glutamyl-tRNA Synthetase; Domain 3

Domain ID domain_id	2re8A03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1160 — Glutamyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Glutamyl-trna Synthetase; Domain 2

Domain ID domain_id	2re8A04
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	240 — Ribosomal Protein L25; Chain P
Homologous superfamily homologous superfamily	10 — Ribosomal Protein L25; Chain P

Domain ID domain_id	2re8A05
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	240 — Ribosomal Protein L25; Chain P
Homologous superfamily homologous superfamily	10 — Ribosomal Protein L25; Chain P

▶

Unit-cell length a length_a	237.142 Å
Unit-cell length b length_b	92.907 Å
Unit-cell length c length_c	115.512 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.600 Å
Low-resolution limit resolution_low	118.600 Å
R factor r_factor	—
R_work r_work	0.2230
R_free r_free	0.2540

Glutaminyl-tRNA synthetase mutant C229R with bound analog 5'-O-[N-(L-GLUTAMYL)-SULFAMOYL]ADENOSINE

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glutaminyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2re8__assembly_1__model_1

2re8__assembly_1__model_1 | I(q)

2re8__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (2 domains)

CATH v4.4 (5 domains)

7. Citations (2)

Glutaminyl-tRNA synthetase mutant C229R with bound analog 5'-O-[N-(L-GLUTAMYL)-SULFAMOYL]ADENOSINE

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glutaminyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2re8__assembly_1__model_1

2re8__assembly_1__model_1 | I(q)

2re8__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (2 domains)

CATH v4.4 (5 domains)

7. Citations (2)