SAXSdb — 3g73

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Forkhead box protein M1

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 222–360 Chain B； UniProt 222–360	Fragment：DNA-binding domain, UNP residues 222-360	;DNA (5'-D(PAPAPAPTPTPGPTPTPTPAPTPAPAPAPCPAPGPCPCPCPG)-3') ; × 1 ;DNA (5'-D(PTPTPCPGPGPGPCPTPGPTPTPTPAPTPAPAPAPCPAPAPT)-3') ; × 1 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；24% PEG3350, 0.2M Sodium Malonate, pH7.5, 3uL Protein at 12g/L mixed with DNA at 0.5mM added tO 3uL of reservoir, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.21 Å R-free 0.234

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 3G73	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
7FJ2 Structure of FOXM1 homodimer bound to a palindromic DNA site Deposited 2021-08-02	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 222–337（116 aa） Chain B 222–337（116 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.7；277 K；50 mM Sodium acetate pH 4.7 250 mM Sodium chloride 15% PEG 3350	Resolution 3.10 Å R-free 0.265
7FJ2 Structure of FOXM1 homodimer bound to a palindromic DNA site Deposited 2021-08-02	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain E 222–337（116 aa） Chain F 222–337（116 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.7；277 K；50 mM Sodium acetate pH 4.7 250 mM Sodium chloride 15% PEG 3350	Resolution 3.10 Å R-free 0.265
9XS1 Crystal structure of FOXM1 DNA binding domain to specific dsDNA substrate Deposited 2025-11-20	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 223–360（138 aa） Fragment：DNA binding domain Chain G 223–360（138 aa） Fragment：DNA binding domain	Not recorded	PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；289 K；10% PEG 20000, 0.1 M Sodium citrate tribasic dihydrate (pH 5.0) and 0.2 M Magnesium chloride hexahydrate	Resolution 2.50 Å R-free 0.249
9XS1 Crystal structure of FOXM1 DNA binding domain to specific dsDNA substrate Deposited 2025-11-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain D 223–360（138 aa） Fragment：DNA binding domain	Not recorded	GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；289 K；10% PEG 20000, 0.1 M Sodium citrate tribasic dihydrate (pH 5.0) and 0.2 M Magnesium chloride hexahydrate	Resolution 2.50 Å R-free 0.249

2 other PDB entries and 4 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	FOXM1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 4–142； UniProt 222–360 Author chain B； PDBConstruct 4–142； UniProt 222–360

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3g73
Deposition date deposition_date	2009-02-09
Structure title title	Structure of the FOXM1 DNA binding
Keywords keywords	;DNA-Binding domain, Forkhead transcription factors, FOXM1, Winged helix, Forkhead, Transcription regulation, TRANSCRIPTION-DNA COMPLEX, Activator, DNA-binding, Nucleus, Phosphoprotein, Transcription ;; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	22.56 Å
Radius of gyration Rg (electron density) rg_electron	21.83 Å
Forward intensity I(0) i0	31524200.00
Molecular weight molecular_weight	35122.0 kDa
Excluded volume excluded_volume	40398 Å³
Envelope volume envelope_volume	53474 Å³
Hydration-shell volume shell_volume	20878 Å³
Envelope diameter envelope_diameter	81.4 Å
Shell Rg shell_rg	28.12 Å
Envelope Rg envelope_rg	22.20 Å
Shape Rg shape_rg	21.78 Å
Total Rg total_rg	22.63 Å
Total atoms total_atoms	2423
Residues n_residues	227
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	79.3 Å
Rg (real space) rg_real	22.56 Å
Rg uncertainty (real space) rg_real_error	0.78 Å
I(0) (real space) i0_real	3.1520e+07
I(0) uncertainty (real space) i0_real_error	4.9420e+05
Rg (reciprocal space) rg_reciprocal	22.56 Å
I(0) (reciprocal space) i0_reciprocal	31520000.0000
Solution quality estimate total_estimate	0.8637
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	27.6 Å
Skewness Skewness skewness	0.358
Kurtosis Kurtosis kurtosis	-0.270
Angular range angular_range	— – 0.3500 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	3125000.0000
Real-space data points n_real_points	67
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.763; Stabil: 0.999; Sysdev: 1.000; Positv: 1.000; Valcen: 0.953; Smooth: 0.985

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Forkhead box protein M1
Molecular weight formula_weight	16600.9 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	2591

GPGPSRPSASWQNSVSERPPYSYMAMIQFAINSTERKRMTLKDIYTWIEDHFPYFKHIAKPGWKNSIRHNLSLHDMFVRETSANGKVSFWTIHPSANRYLTLDQVFKPLDPGSPQLPEHLESQQKRPNPELRRNMTIKTELP

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	Human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(PAPAPAPTPTPGPTPTPTPAPTPAPAPAPCPAPGPCPCPCP*G)-3') ;
Molecular weight formula_weight	6430.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

AAATTGTTTATAAACAGCCCG

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(PTPTPCPGPGPGPCPTPGPTPTPTPAPTPAPAPAPCPAPAP*T)-3') ;
Molecular weight formula_weight	6452.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

TTCGGGCTGTTTATAAACAAT

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	163

▼

7. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

Domain ID domain_id	3g73A00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	3g73B00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

▶

8. Citations (1)

▶

Unit-cell length a length_a	63.070 Å
Unit-cell length b length_b	119.750 Å
Unit-cell length c length_c	152.970 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.210 Å
Low-resolution limit resolution_low	32.940 Å
R factor r_factor	0.2056
R_work r_work	0.2040
R_free r_free	0.2343

fit	/app/data/saxs_computation/g7/3g73/3g73.fit
pddf	/app/data/pr_computation/g7/3g73/3g73.pr.out
profile	/app/data/saxs_computation/g7/3g73/3g73.dat

Structure of the FOXM1 DNA binding

1. Protein Identity and Related Structures Protein Identity & Related Structures

Forkhead box protein M1

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)