SAXSdb — 9xs1

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Forkhead box protein M1

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 223–360 Chain G； UniProt 223–360	Fragment：DNA binding domain	;DNA (5'-D(TPTPTPGPTPTPTPAPTPTPTPGPTPTPTPGPTPTPTPAPTPTPTPG)-3') ; × 1 ;DNA (5'-D(CPAPAPAPTPAPAPAPCPAPAPAPCPAPAPAPTPAPAPAPCPAPAPA)-3') ; × 1 PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；289 K；10% PEG 20000, 0.1 M Sodium citrate tribasic dihydrate (pH 5.0) and 0.2 M Magnesium chloride hexahydrate	Resolution 2.50 Å R-free 0.249
2	Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain D； UniProt 223–360	Fragment：DNA binding domain	;DNA (5'-D(TPTPTPGPTPTPTPAPTPTPTPGPTPTPTPGPTPTPTPAPTPTPTPG)-3') ; × 1 ;DNA (5'-D(CPAPAPAPTPAPAPAPCPAPAPAPCPAPAPAPTPAPAPAPCPAPAPA)-3') ; × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；289 K；10% PEG 20000, 0.1 M Sodium citrate tribasic dihydrate (pH 5.0) and 0.2 M Magnesium chloride hexahydrate	Resolution 2.50 Å R-free 0.249

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9XS1	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
3G73 Structure of the FOXM1 DNA binding Deposited 2009-02-09	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 222–360（139 aa） Fragment：DNA-binding domain, UNP residues 222-360 Chain B 222–360（139 aa） Fragment：DNA-binding domain, UNP residues 222-360	Not recorded	MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；24% PEG3350, 0.2M Sodium Malonate, pH7.5, 3uL Protein at 12g/L mixed with DNA at 0.5mM added tO 3uL of reservoir, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.21 Å R-free 0.234
7FJ2 Structure of FOXM1 homodimer bound to a palindromic DNA site Deposited 2021-08-02	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 222–337（116 aa） Chain B 222–337（116 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.7；277 K；50 mM Sodium acetate pH 4.7 250 mM Sodium chloride 15% PEG 3350	Resolution 3.10 Å R-free 0.265
7FJ2 Structure of FOXM1 homodimer bound to a palindromic DNA site Deposited 2021-08-02	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain E 222–337（116 aa） Chain F 222–337（116 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.7；277 K；50 mM Sodium acetate pH 4.7 250 mM Sodium chloride 15% PEG 3350	Resolution 3.10 Å R-free 0.265

2 other PDB entries and 3 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	FOXM1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–138； UniProt 223–360 Author chain D； PDBConstruct 1–138； UniProt 223–360 Author chain G； PDBConstruct 1–138； UniProt 223–360

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9xs1
Deposition date deposition_date	2025-11-20
最后修订 last_revision	2026-04-15
Structure title title	Crystal structure of FOXM1 DNA binding domain to specific dsDNA substrate
Keywords keywords	transcription factor, DNA-binding domain, DNA BINDING PROTEIN/DNA, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	30.10 Å
Radius of gyration Rg (electron density) rg_electron	28.77 Å
Forward intensity I(0) i0	84554400.00
Molecular weight molecular_weight	54382.0 kDa
Excluded volume excluded_volume	60099 Å³
Envelope volume envelope_volume	89721 Å³
Hydration-shell volume shell_volume	27234 Å³
Envelope diameter envelope_diameter	97.2 Å
Shell Rg shell_rg	34.39 Å
Envelope Rg envelope_rg	28.13 Å
Shape Rg shape_rg	28.66 Å
Total Rg total_rg	29.44 Å
Total atoms total_atoms	3717
Residues n_residues	310
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	92.5 Å
Rg (real space) rg_real	30.01 Å
Rg uncertainty (real space) rg_real_error	0.75 Å
I(0) (real space) i0_real	8.4550e+07
I(0) uncertainty (real space) i0_real_error	1.2580e+06
Rg (reciprocal space) rg_reciprocal	30.05 Å
I(0) (reciprocal space) i0_reciprocal	84560000.0000
Solution quality estimate total_estimate	0.8954
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	45.4 Å
Skewness Skewness skewness	0.080
Kurtosis Kurtosis kurtosis	-0.636
Angular range angular_range	— – 0.2650 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	3917000.0000
Real-space data points n_real_points	54
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.936; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.991; Smooth: 0.836

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Forkhead box protein M1
Molecular weight formula_weight	16292.5 kDa
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,D,G
Atom count atom_count	3737

SRPSASWQNSVSERPPYSYMAMIQFAINSTERKRMTLKDIYTWIEDHFPYFKHIAKPGWKNSIRHNLSLHDMFVRETSANGKVSFWTIHPSANRYLTLDQVFKPLDPGSPQLPEHLESQQKRPNPELRRNMTIKTELP

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(TPTPTPGPTPTPTPAPTPTPTPGPTPTPTPGPTPTPTPAPTPTPTPG)-3') ;
Molecular weight formula_weight	7373.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,B

TTTGTTTATTTGTTTGTTTATTTG

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(CPAPAPAPTPAPAPAPCPAPAPAPCPAPAPAPTPAPAPAPCPAPAPA)-3') ;
Molecular weight formula_weight	7357.9 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F,C

CAAATAAACAAACAAATAAACAAA

Entity 4 Entity 4 non-polymer

Description description	GLYCEROL
Molecular weight formula_weight	92.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	PHOSPHATE ION
Molecular weight formula_weight	95.0 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	20

▶

8. Citations (1)

▶

Unit-cell length a length_a	72.210 Å
Unit-cell length b length_b	45.610 Å
Unit-cell length c length_c	213.494 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	95.82 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	I 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	2.500 Å
Low-resolution limit resolution_low	30.400 Å
R factor r_factor	0.2144
R_work r_work	0.2126
R_free r_free	0.2486

fit	/app/data/saxs_computation/xs/9xs1/9xs1.fit
pddf	/app/data/pr_computation/xs/9xs1/9xs1.pr.out
profile	/app/data/saxs_computation/xs/9xs1/9xs1.dat

Crystal structure of FOXM1 DNA binding domain to specific dsDNA substrate

1. Protein Identity and Related Structures Protein Identity & Related Structures

Forkhead box protein M1

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)