4gdf

A Crystal Structure of SV40 Large T Antigen

Method: X-RAY DIFFRACTION D_max: 148.8 Å Quality: REASONABLE

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Large T antigen

Simian virus 40

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 131–627 Chain B； UniProt 131–627	Fragment：UNP residues 131-627	DNA (32-MER) × 1 DNA (32-MER) × 1 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 6.75；291 K；100 mM bis-Tris (pH 6.75), 20% (v/v) PEG3350, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.80 Å R-free 0.255
2	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain E； UniProt 131–627 Chain F； UniProt 131–627	Fragment：UNP residues 131-627	DNA (32-MER) × 1 DNA (32-MER) × 1 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 6.75；291 K；100 mM bis-Tris (pH 6.75), 20% (v/v) PEG3350, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.80 Å R-free 0.255

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 4GDF	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
2H1L The Structure of the Oncoprotein SV40 Large T Antigen and p53 Tumor Suppressor Complex Deposited 2006-05-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 12 PDB declaration: dodecameric	Chain A 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain B 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain C 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain D 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain E 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain F 260–627（368 aa） Fragment：Helicase Domain, residues 260-627	Not recorded	ZN ZINC ION × 12	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 6.5；298 K；5.4% PEG 4000, 73mM Mops Buffer, 22mM Lithium Sulfate, pH 6.5, VAPOR DIFFUSION, temperature 298K	Resolution 3.16 Å R-free 0.308
2H1L The Structure of the Oncoprotein SV40 Large T Antigen and p53 Tumor Suppressor Complex Deposited 2006-05-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 12 PDB declaration: dodecameric	Chain G 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain H 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain I 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain J 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain K 260–627（368 aa） Fragment：Helicase Domain, residues 260-627 Chain L 260–627（368 aa） Fragment：Helicase Domain, residues 260-627	Not recorded	ZN ZINC ION × 12	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 6.5；298 K；5.4% PEG 4000, 73mM Mops Buffer, 22mM Lithium Sulfate, pH 6.5, VAPOR DIFFUSION, temperature 298K	Resolution 3.16 Å R-free 0.308
4E2I The Complex Structure of the SV40 Helicase Large T Antigen and p68 Subunit of DNA Polymerase Alpha-Primase Deposited 2012-03-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 12 PDB declaration: dodecameric	Chain A 266–627（362 aa） Fragment：UNP residues 266-627 Chain B 266–627（362 aa） Fragment：UNP residues 266-627 Chain C 266–627（362 aa） Fragment：UNP residues 266-627 Chain D 266–627（362 aa） Fragment：UNP residues 266-627 Chain E 266–627（362 aa） Fragment：UNP residues 266-627 Chain F 266–627（362 aa） Fragment：UNP residues 266-627	Not recorded	ZN ZINC ION × 6	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；291 K；0.96 M sodium malonate, pH 6.0, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 5.00 Å R-free 0.314
4E2I The Complex Structure of the SV40 Helicase Large T Antigen and p68 Subunit of DNA Polymerase Alpha-Primase Deposited 2012-03-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 11 PDB declaration: undecameric	Chain G 266–627（362 aa） Fragment：UNP residues 266-627 Chain H 266–627（362 aa） Fragment：UNP residues 266-627 Chain I 266–627（362 aa） Fragment：UNP residues 266-627 Chain J 266–627（362 aa） Fragment：UNP residues 266-627 Chain K 266–627（362 aa） Fragment：UNP residues 266-627 Chain L 266–627（362 aa） Fragment：UNP residues 266-627	Not recorded	ZN ZINC ION × 6	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；291 K；0.96 M sodium malonate, pH 6.0, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 5.00 Å R-free 0.314

2 other PDB entries and 4 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	Q9DH70_SV40
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–497； UniProt 131–627 Author chain B； PDBConstruct 1–497； UniProt 131–627 Author chain E； PDBConstruct 1–497； UniProt 131–627 Author chain F； PDBConstruct 1–497； UniProt 131–627

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4gdf
Deposition date deposition_date	2012-07-31
Structure title title	A Crystal Structure of SV40 Large T Antigen
Keywords keywords	SV40 Large T Antigen, DNA replication, helicase, primase, HYDROLASE-DNA complex; HYDROLASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	47.46 Å
Radius of gyration Rg (electron density) rg_electron	47.01 Å
Forward intensity I(0) i0	1203420000.00
Molecular weight molecular_weight	269130.0 kDa
Excluded volume excluded_volume	328840 Å³
Envelope volume envelope_volume	485600 Å³
Hydration-shell volume shell_volume	85554 Å³
Envelope diameter envelope_diameter	160.0 Å
Shell Rg shell_rg	52.40 Å
Envelope Rg envelope_rg	45.17 Å
Shape Rg shape_rg	47.00 Å
Total Rg total_rg	47.22 Å
Total atoms total_atoms	18756
Residues n_residues	2116
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	148.8 Å
Rg (real space) rg_real	47.93 Å
Rg uncertainty (real space) rg_real_error	0.43 Å
I(0) (real space) i0_real	1.1810e+09
I(0) uncertainty (real space) i0_real_error	1.7840e+07
Rg (reciprocal space) rg_reciprocal	47.46 Å
I(0) (reciprocal space) i0_reciprocal	1204000000.0000
Solution quality estimate total_estimate	0.7059
Solution quality rating solution_quality	REASONABLE a REASONABLE solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	63.1 Å
Skewness Skewness skewness	0.196
Kurtosis Kurtosis kurtosis	-0.298
Angular range angular_range	— – 0.1650 Å⁻¹
Current regularization parameter α current_alpha	1.7130
Highest regularization parameter α highest_alpha	72160000.0000
Real-space data points n_real_points	34
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.929; Stabil: 0.925; Sysdev: 0.000; Positv: 1.000; Valcen: 0.970; Smooth: 0.655

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Large T antigen
Molecular weight formula_weight	57450.4 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,E,F
Atom count atom_count	18835

KVEDPKDFPSELLSFLSHAVFSNRTLACFAIYTTKEKAALLYKKIMEKYSVTFISRHNSYNHNILFFLTPHRHRVSAINNYAQKLCTFSFLICKGVNKEYLMYSALTRDPFSVIEESLPGGLKEHDFNPEEAEETKQVSWKLVTEYAMETKCDDVLLLLGMYLEFQYSFEMCLKCIKKEQPSHYKYHEKHYANAAIFADSKNQKTICQQAVDTVLAKKRVDSLQLTREQMLTNRFNDLLDRMDIMFGSTGSADIEEWMAGVAWLHCLLPKMDSVVYDFLKCMVYNIPKKRYWLFKGPIDSGKTTLAAALLELCGGKALNVNLPLDRLNFELGVAIDQFLVVFEDVKGTGGESRDLPSGQGINNLDNLRDYLDGSVKVNLEKKHLNKRTQIFPPGIVTMNEYSVPKTLQARFVKQIDFRPKDYLKHCLERSEFLLEKRIIQSGIALLLMLIWYRPVAEFAQSIQSRIVEWKERLDKEFSLSVYQKMKFNVAMGIGVLD

来源 Source

来源生物 organism	Simian virus 40
通用名 common_name	SV40
NCBI Class编号 ncbi_taxonomy_id	10633
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA (32-MER)
Molecular weight formula_weight	9891.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,G

ACTACTTCTGGAATAGCTCAGAGGCCGAGGCG

Entity 3 Entity 3 polymer

Description description	DNA (32-MER)
Molecular weight formula_weight	9793.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D,H

CGCCTCGGCCTCTGAGCTATTCCAGAAGTAGT

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	79

▼

7. Fold Classification (SCOP + CATH) 16 domains

CATH v4.4 (16 domains)

Domain ID domain_id	4gdfA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1310 — Replication Protein E1; Chain: A,
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4gdfA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	510 — Zinc finger, large T-antigen D1 domain

Domain ID domain_id	4gdfA03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1050 — Glutathione S-transferase Yfyf (Class Pi); Chain A, domain 2
Homologous superfamily homologous superfamily	70 — Large T antigen, SV40, domain 3

Domain ID domain_id	4gdfA04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4gdfB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1310 — Replication Protein E1; Chain: A,
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4gdfB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	510 — Zinc finger, large T-antigen D1 domain

Domain ID domain_id	4gdfB03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1050 — Glutathione S-transferase Yfyf (Class Pi); Chain A, domain 2
Homologous superfamily homologous superfamily	70 — Large T antigen, SV40, domain 3

Domain ID domain_id	4gdfB04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4gdfE01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1310 — Replication Protein E1; Chain: A,
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4gdfE02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	510 — Zinc finger, large T-antigen D1 domain

Domain ID domain_id	4gdfE03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1050 — Glutathione S-transferase Yfyf (Class Pi); Chain A, domain 2
Homologous superfamily homologous superfamily	70 — Large T antigen, SV40, domain 3

Domain ID domain_id	4gdfE04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4gdfF01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1310 — Replication Protein E1; Chain: A,
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4gdfF02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	510 — Zinc finger, large T-antigen D1 domain

Domain ID domain_id	4gdfF03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1050 — Glutathione S-transferase Yfyf (Class Pi); Chain A, domain 2
Homologous superfamily homologous superfamily	70 — Large T antigen, SV40, domain 3

Domain ID domain_id	4gdfF04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

▶

8. Citations (1)

▶

Unit-cell length a length_a	73.633 Å
Unit-cell length b length_b	128.307 Å
Unit-cell length c length_c	166.120 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	89.91 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	—
R_work r_work	0.2269
R_free r_free	0.2549

fit	/app/data/saxs_computation/gd/4gdf/4gdf.fit
pddf	/app/data/pr_computation/gd/4gdf/4gdf.pr.out
profile	/app/data/saxs_computation/gd/4gdf/4gdf.dat

A Crystal Structure of SV40 Large T Antigen

1. Protein Identity and Related Structures Protein Identity & Related Structures

Large T antigen

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Fold Classification (SCOP + CATH) 16 domains

CATH v4.4 (16 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)