SAXSdb — 4krf

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protein argonaute-1

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	;RNA (5'-R(PUPGPAPGPGPUPAPGPUPAPGPGPUPUPGPUPAPUPAPGPUPU)-3') ; × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	AGO1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–858； UniProt 1–857

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4krf
Deposition date deposition_date	2013-05-16
Structure title title	Structure of Human Argonaute-1 let-7 complex
Keywords keywords	eukaryotic Argonaute, GENE REGULATION, RNAi, Slicer, TRANSCRIPTION-RNA complex; TRANSCRIPTION/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4krf__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4krf__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4krf__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	30.86 Å
Rg (electron density)	30.34 Å
Total Rg	31.00 Å
Atom count	6839
Residues	829
Excluded volume	121580 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4krf__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	Protein argonaute-1
Molecular weight formula_weight	97420.4 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	7206

AMEAGPSGAAAGAYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 2 Entity 2 polymer

Description description	;RNA (5'-R(PUPGPAPGPGPUPAPGPUPAPGPGPUPUPGPUPAPUPAPGPUPU)-3') ;
Molecular weight formula_weight	7118.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R

UGAGGUAGUAGGUUGUAUAGUU

Entity 3 Entity 3 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	367

▼

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d4krfa1
Class class	b — All beta proteins
Fold Fold fold	b.34 — SH3-like barrel
Superfamily Superfamily superfamily	b.34.14 — PAZ domain
Family Family family	b.34.14.0 — automated matches

Domain ID domain_id	d4krfa2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.44 — Phosphotyrosine protein phosphatases I-like
Superfamily Superfamily superfamily	c.44.3 — PIWI domain N-terminal-like
Family Family family	c.44.3.0 — automated matches

Domain ID domain_id	d4krfa3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.55 — Ribonuclease H-like motif
Superfamily Superfamily superfamily	c.55.3 — Ribonuclease H-like
Family Family family	c.55.3.0 — automated matches

CATH v4.4 (3 domains)

Domain ID domain_id	4krfA02
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	260 — paz domain
Homologous superfamily homologous superfamily	10 — paz domain

Domain ID domain_id	4krfA03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	4krfA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

▶

Unit-cell length a length_a	70.390 Å
Unit-cell length b length_b	97.730 Å
Unit-cell length c length_c	72.700 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	110.89 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	2

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.101 Å
Low-resolution limit resolution_low	40.568 Å
R factor r_factor	0.1772
R_work r_work	0.1755
R_free r_free	0.2173

Structure of Human Argonaute-1 let-7 complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protein argonaute-1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4krf__assembly_1__model_1

4krf__assembly_1__model_1 | I(q)

4krf__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (3 domains)

CATH v4.4 (3 domains)

7. Citations (1)

Structure of Human Argonaute-1 let-7 complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protein argonaute-1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4krf__assembly_1__model_1

4krf__assembly_1__model_1 | I(q)

4krf__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (3 domains)

CATH v4.4 (3 domains)

7. Citations (1)