SAXSdb — 4pkd

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

U1 small nuclear ribonucleoprotein A,U1 small nuclear ribonucleoprotein 70 kDa

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 RNA 1	U1 snRNA stem-loops 1 and 2 (55-MER) × 1 MAGNESIUM ION × 3 IMIDAZOLE × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RU17_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 124–279； UniProt 60–215

U1 small nuclear ribonucleoprotein A,U1 small nuclear ribonucleoprotein 70 kDa

Homo sapiens

UniProt Q06AA4

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 RNA 1	U1 snRNA stem-loops 1 and 2 (55-MER) × 1 MAGNESIUM ION × 3 IMIDAZOLE × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SNRPA_PIG
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–110； UniProt 2–111

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4pkd
Deposition date deposition_date	2014-05-14
Structure title title	U1-70k in complex with U1 snRNA stem-loops 1 and U1-A RRM in complex with stem-loop 2
Keywords keywords	U1-70k, U1 snRNP, Pre-mRNA splicing, Spliceosome, gene regulation; GENE REGULATION
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4pkd__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4pkd__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4pkd__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	31.71 Å
Rg (electron density)	34.57 Å
Total Rg	34.28 Å
Atom count	3139
Residues	294
Excluded volume	51330 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4pkd__assembly_1__model_1`	Dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	U1 snRNA stem-loops 1 and 2 (55-MER)
Molecular weight formula_weight	17786.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	V
Atom count atom_count	3252

GGAUCCAUUGCACUCCGGAUCCAGGAGAUACCAUGAUCACGAAGGUGGUUUUCCU

Entity 2 Entity 2 polymer

Description description	U1 small nuclear ribonucleoprotein A,U1 small nuclear ribonucleoprotein 70 kDa
Molecular weight formula_weight	32183.6 kDa
Mutation mutation	A2G
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

GVPETRPNHTIYINNLNEKIKKDELKKSLYAIFSQFGQILDILVSRSLKMRGQAFVIFKEVSSATNALRSMQGFPFYDKPMRIQYAKTDSDIIAKMKGTFVERDRKREKRGSGSGSGSGSGSGAETREERMERKRREKIERRQQEVETELKMWDPHNDPNAQGDAFKTLFVARVNYDTTESKLRREFEVYGPIKRIHMVYSKRSGKPRGYAFIEYEHERDMHSAYKHADGKKIDGRRVLVDVERGRTVKGWRPRRLGGGLGGTRRGGADVNIRHSGRDD

Source Source

Source organism organism	Homo sapiens
Common name common_name	Human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 4 Entity 4 non-polymer

Description description	IMIDAZOLE
Molecular weight formula_weight	69.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	113

▼

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

Domain ID domain_id	4pkdB01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	330 — RRM (RNA recognition motif) domain

Domain ID domain_id	4pkdB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	330 — RRM (RNA recognition motif) domain

▶

Unit-cell length a length_a	80.220 Å
Unit-cell length b length_b	66.600 Å
Unit-cell length c length_c	93.730 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	110.95 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	2.500 Å
Low-resolution limit resolution_low	87.000 Å
R factor r_factor	0.1999
R_work r_work	0.1968
R_free r_free	0.2579

U1-70k in complex with U1 snRNA stem-loops 1 and U1-A RRM in complex with stem-loop 2

1. Protein Identity and Related Structures Protein Identity & Related Structures

U1 small nuclear ribonucleoprotein A,U1 small nuclear ribonucleoprotein 70 kDa

State in the Current Structure

Other States of the Same Protein in the Database

U1 small nuclear ribonucleoprotein A,U1 small nuclear ribonucleoprotein 70 kDa

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4pkd__assembly_1__model_1

4pkd__assembly_1__model_1 | I(q)

4pkd__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

7. Citations (4)

U1-70k in complex with U1 snRNA stem-loops 1 and U1-A RRM in complex with stem-loop 2

1. Protein Identity and Related Structures Protein Identity & Related Structures

U1 small nuclear ribonucleoprotein A,U1 small nuclear ribonucleoprotein 70 kDa

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

U1 small nuclear ribonucleoprotein A,U1 small nuclear ribonucleoprotein 70 kDa

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4pkd__assembly_1__model_1

4pkd__assembly_1__model_1 | I(q)

4pkd__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

7. Citations (4)