SAXSdb — 4plb

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Chimera protein of DNA gyrase subunits B and A

Staphylococcus aureus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Homooligomer	Protein 2 DNA 2	;DNA (5'-D(PAPGPCPCPGPTPAPGPGPGPCPCPCPTPAPCPGPGPCPT)-3') ; × 2 ;6-[({(1r,4S)-1-[(1S)-2-(3-fluoro-6-methoxy-1,5-naphthyridin-4-yl)-1-hydroxyethyl]-2-oxabicyclo[2.2.2]oct-4-yl}amino)methyl]-2H-pyrido[3,2-b][1,4]oxazin-3(4H)-one ; × 1 SULFATE ION × 3 MANGANESE (II) ION × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GYRB_STAAU
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 2–135； UniProt 410–543 Author chain B； PDBConstruct 138–202； UniProt 580–644 Author chain D； PDBConstruct 2–135； UniProt 410–543 Author chain D； PDBConstruct 138–202； UniProt 580–644

Chimera protein of DNA gyrase subunits B and A

Staphylococcus aureus

UniProt P20831

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Homooligomer	Protein 2 DNA 2	;DNA (5'-D(PAPGPCPCPGPTPAPGPGPGPCPCPCPTPAPCPGPGPCPT)-3') ; × 2 ;6-[({(1r,4S)-1-[(1S)-2-(3-fluoro-6-methoxy-1,5-naphthyridin-4-yl)-1-hydroxyethyl]-2-oxabicyclo[2.2.2]oct-4-yl}amino)methyl]-2H-pyrido[3,2-b][1,4]oxazin-3(4H)-one ; × 1 SULFATE ION × 3 MANGANESE (II) ION × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GYRA_STAAU
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 203–692； UniProt 2–491 Author chain D； PDBConstruct 203–692； UniProt 2–491

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4plb
Deposition date deposition_date	2014-05-16
Structure title title	Crystal Structure of S.A. gyrase-AM8191 complex
Keywords keywords	gyase inhibitor complex, ISOMERASE-ISOMERASE Inhibitor-DNA complex; ISOMERASE/ISOMERASE Inhibitor/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4plb__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4plb__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4plb__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.06 Å
Rg (electron density)	36.79 Å
Total Rg	37.16 Å
Atom count	11399
Residues	1381
Excluded volume	199330 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4plb__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	;DNA (5'-D(PAPGPCPCPGPTPAPGPGPGPCPCPCPTPAPCPGPGPCPT)-3') ;
Molecular weight formula_weight	6136.0 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,F
Atom count atom_count	11503

AGCCGTAGGGCCCTACGGCT

Entity 2 Entity 2 polymer

Description description	Chimera protein of DNA gyrase subunits B and A
Molecular weight formula_weight	78074.9 kDa
EC 编号 ec_number	5.99.1.3
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,D

PDVASLPGKLADCSSKSPEECEIFLVEGDSAGGSTKSGRDSRTQAILPLRGKILNVEKARLDRILNNNEIRQMITAFGTGIGGDFDLAKARYHKIVIMTDADVDGAHIRTLLLTFFYRFMRPLIEAGYVYIAQPPTGYKGLGEMNADQLWETTMNPEHRALLQVKLEDAIEADQTFEMLMGDVVENRRQFIEDNAVYANLDFAELPQSRINERNITSEMRESFLDYAMSVIVARALPDVRDGLKPVHRRILYGLNEQGMTPDKSYKKSARIVGDVMGKYHPHGDSSIYEAMVRMAQDFSYRYPLVDGQGNFGSMDGDGAAAMRFTEARMTKITLELLRDINKDTIDFIDNYDGNEREPSVLPARFPNLLANGASGIAVGMATNIPPHNLTELINGVLSLSKNPDISIAELMEDIEGPDFPTAGLILGKSGIRRAYETGRGSIQMRSRAVIEERGGGRQRIVVTEIPFQVNKARMIEKIAELVRDKKIDGITDLRDETSLRTGVRVVIDVRKDANASVILNNLYKQTPLQTSFGVNMIALVNGRPKLINLKEALVHYLEHQKTVVRRRTQYNLRKAKDRAHILEGLRIALDHIDEIISTIRESDTDKVAMESLQQRFKLSEKQAQAILDMRLRRLTGLERDKIEAEYNELLNYISELETILADEEVLLQLVRDELTEIRDRFGDDRRTEIQLG

Source Source

Source organism organism	Staphylococcus aureus
NCBI taxonomy ID ncbi_taxonomy_id	1280
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	;6-[({(1r,4S)-1-[(1S)-2-(3-fluoro-6-methoxy-1,5-naphthyridin-4-yl)-1-hydroxyethyl]-2-oxabicyclo[2.2.2]oct-4-yl}amino)methyl]-2H-pyrido[3,2-b][1,4]oxazin-3(4H)-one ;
Molecular weight formula_weight	509.5 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 non-polymer

Description description	MANGANESE (II) ION
Molecular weight formula_weight	54.9 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	73

▼

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

Domain ID domain_id	4plbB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	670 —

Domain ID domain_id	4plbD01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	670 —

▶

Unit-cell length a length_a	93.310 Å
Unit-cell length b length_b	93.310 Å
Unit-cell length c length_c	410.197 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 61
Space-group number int_tables_number	169
Crystal system crystal_system	—

Resolution resolution	2.690 Å
Low-resolution limit resolution_low	27.120 Å
R factor r_factor	0.1788
R_work r_work	0.1765
R_free r_free	0.2200

Crystal Structure of S.A. gyrase-AM8191 complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Chimera protein of DNA gyrase subunits B and A

State in the Current Structure

Other States of the Same Protein in the Database

Chimera protein of DNA gyrase subunits B and A

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4plb__assembly_1__model_1

4plb__assembly_1__model_1 | I(q)

4plb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

7. Citations (1)

Crystal Structure of S.A. gyrase-AM8191 complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Chimera protein of DNA gyrase subunits B and A

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Chimera protein of DNA gyrase subunits B and A

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4plb__assembly_1__model_1

4plb__assembly_1__model_1 | I(q)

4plb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

7. Citations (1)