5n6i

Crystal structure of mouse cGAS in complex with 39 bp DNA

Method: X-RAY DIFFRACTION D_max: 188.7 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cyclic GMP-AMP synthase

Mus musculus

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 6 DNA 8 PDB declaration: tetradecameric（14） Consistent with all polymer counts	Chain A； UniProt 139–507 Chain B； UniProt 139–507 Chain C； UniProt 139–507 Chain D； UniProt 139–507 Chain E； UniProt 139–507 Chain F； UniProt 139–507	Not recorded	DNA (37-MER) × 4 DNA (36-MER) × 4 ZN ZINC ION × 6	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 8；293.15 K；0.1M Tris pH 8, 0.2M ammonium citrate pH 7, 27,5% w/v PEG3350	Resolution 3.60 Å R-free 0.256

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 5N6I	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
4K8V Structure of cyclic GMP-AMP Synthase (cGAS) Deposited 2013-04-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；277 K；0.1 M HEPES, 0.1 M MgAc2, 20% PEG3350, pH 7.6, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.208
4K8V Structure of cyclic GMP-AMP Synthase (cGAS) Deposited 2013-04-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；277 K；0.1 M HEPES, 0.1 M MgAc2, 20% PEG3350, pH 7.6, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.208
4K8V Structure of cyclic GMP-AMP Synthase (cGAS) Deposited 2013-04-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；277 K；0.1 M HEPES, 0.1 M MgAc2, 20% PEG3350, pH 7.6, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.208
4K8V Structure of cyclic GMP-AMP Synthase (cGAS) Deposited 2013-04-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain D 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；277 K；0.1 M HEPES, 0.1 M MgAc2, 20% PEG3350, pH 7.6, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.208
4K96 Structure of Binary Complex of cGAS with Bound dsDNA Deposited 2013-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.6；293 K；0.1 M MES, 8% MPD, pH 6.6, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.08 Å R-free 0.226
4K96 Structure of Binary Complex of cGAS with Bound dsDNA Deposited 2013-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.6；293 K；0.1 M MES, 8% MPD, pH 6.6, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.08 Å R-free 0.226
4K97 Structure of Ternary Complex of cGAS with dsDNA and Bound ATP Deposited 2013-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1 MG MAGNESIUM ION × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.7；293 K；0.1 M HEPES, 0.2 M CaAc2, 20% PEG300, pH 7.7, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.41 Å R-free 0.236
4K98 Structure of Ternary Complex of cGAS with dsDNA and Bound 5 -pppG(2 ,5 )pG Deposited 2013-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1 MG MAGNESIUM ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1 5GP GUANOSINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5；293 K；0.1 M NaAc, 10% MPD, pH 5.0, VAPOR DIFFUSION, SITTING DROP, temperature 293K	Resolution 1.94 Å R-free 0.199
4K99 Structure of Ternary Complex of cGAS with dsDNA and Bound 5 -pppdG(2 ,5 )pdG Deposited 2013-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1 MG MAGNESIUM ION × 2 GH3 3'-DEOXY-GUANOSINE-5'-TRIPHOSPHATE × 1 GDO 3'-deoxy-guanosine 5'-monophosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.2；293 K；0.1 M NaAc, 12% MPD, pH 5.2, VAPOR DIFFUSION, SITTING DROP, temperature 293K	Resolution 1.95 Å R-free 0.212
4K9A Structure of Ternary Complex of cGAS with dsDNA and Bound 5 -pG(2 ,5 )pA Deposited 2013-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1 PO4 PHOSPHATE ION × 1 5GP GUANOSINE-5'-MONOPHOSPHATE × 1 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；293 K；0.1 M MES, 40% MPD, pH 6.0, VAPOR DIFFUSION, SITTING DROP, temperature 293K	Resolution 2.26 Å R-free 0.210
4K9B Structure of Ternary Complex of cGAS with dsDNA and Bound c[G(2 ,5 )pA(3 ,5 )p] Deposited 2013-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 147–507（361 aa） Fragment：C-TERMINAL DOMAIN, UNP residues 147-507	Not recorded	ZN ZINC ION × 1 PO4 PHOSPHATE ION × 1 5GP GUANOSINE-5'-MONOPHOSPHATE × 1 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；0.1 M HEPES, 0.2 M MgCl2, 30% PEG300, pH 7.5, VAPOR DIFFUSION, SITTING DROP, temperature 293K	Resolution 2.26 Å R-free 0.217
4LEY Structure of mouse cGAS bound to 18 bp DNA Deposited 2013-06-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 142–507（366 aa） Fragment：Catalytic domain, UNP residues 142-507 Chain C 142–507（366 aa） Fragment：Catalytic domain, UNP residues 142-507	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277 K；24-36% MPD, pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.50 Å R-free 0.191
4LEY Structure of mouse cGAS bound to 18 bp DNA Deposited 2013-06-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain B 142–507（366 aa） Fragment：Catalytic domain, UNP residues 142-507 Chain D 142–507（366 aa） Fragment：Catalytic domain, UNP residues 142-507	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277 K；24-36% MPD, pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.50 Å R-free 0.191
4LEZ Structure of mouse cGAS bound to an 18bp DNA and cGAS product Deposited 2013-06-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 142–507（366 aa） Fragment：mouse cGAS catalytic domain, UNP residues 142-507 Chain C 142–507（366 aa） Fragment：mouse cGAS catalytic domain, UNP residues 142-507	Not recorded	ZN ZINC ION × 2 1SY cGAMP × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277 K；24-36% MPD, pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.36 Å R-free 0.247
4O6A Mouse cyclic GMP-AMP synthase (cGAS) in complex with DNA Deposited 2013-12-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：UNP residues 147-507 Chain B 147–507（361 aa） Fragment：UNP residues 147-507	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；25% Methanol, 0.1M Tris-HCl, pH 8.0, 0.01M MgCl2., VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 1.86 Å R-free 0.218
5XZB Mouse cGAS bound to the inhibitor RU365 Deposited 2017-07-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 149–505（357 aa） Fragment：UNP residues 149-505	Not recorded	ZN ZINC ION × 1 A9Y (3R)-3-[1-(1H-benzimidazol-2-yl)-5-hydroxy-3-methyl-1H-pyrazol-4-yl]-2-benzofuran-1(3H)-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；0.1 M MES, pH 6.3, 26% PEG400, 0.1 M magnesium chloride	Resolution 2.13 Å R-free 0.247
5XZE Mouse cGAS bound to the inhibitor RU332 Deposited 2017-07-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 147–507（361 aa） Fragment：UNP residues 147-505	Not recorded	ZN ZINC ION × 1 AE7 (3R)-3-[1-(3H-1lambda~4~,3-benzothiazol-2-yl)-5-hydroxy-3-methyl-1H-pyrazol-4-yl]-2-benzofuran-1(3H)-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；0.1 M MES, pH 6.3, 25% PEG400, 0.1 M magnesium chloride	Resolution 2.18 Å R-free 0.281
5XZG Mouse cGAS bound to the inhibitor RU521 Deposited 2017-07-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 147–507（361 aa） Fragment：UNP residues 147-505	Not recorded	ZN ZINC ION × 1 AEV 2-(4,5-dichloro-1H-benzimidazol-2-yl)-5-methyl-4-[(1R)-3-oxo-1,3-dihydro-2-benzofuran-1-yl]-1,2-dihydro-3H-pyrazol-3-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；0.1 M MES, pH 6.9, 22.5% PEG400, 0.08 M magnesium chloride	Resolution 1.83 Å R-free 0.232
6X59 The mouse cGAS catalytic domain binding to human assembled nucleosome Deposited 2020-05-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 9 PDB declaration: undecameric	Chain K 142–507（366 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.98 Å
6X5A The mouse cGAS catalytic domain binding to human nucleosome that purified from HEK293T cells Deposited 2020-05-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 9 PDB declaration: undecameric	Chain K 142–507（366 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.36 Å
6XJD Two mouse cGAS catalytic domain binding to human assembled nucleosome Deposited 2020-06-23	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 10 PDB declaration: dodecameric	Chain K 142–507（366 aa） Chain L 142–507（366 aa）	Not recorded	ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 6.80 Å
7A08 CryoEM Structure of cGAS Nucleosome complex Deposited 2020-08-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 9 PDB declaration: undecameric	Chain a 139–507（369 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.11 Å
7BUJ mcGAS bound with pppGpG Deposited 2020-04-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 61–507（447 aa） Chain B 61–507（447 aa）	Not recorded	ZN ZINC ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 2 MN MANGANESE (II) ION × 4 5GP GUANOSINE-5'-MONOPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；0.15 M Ammonium sulfate, 0.1 M Sodium HEPES, 20 % w/v PEG-4000, pH 6.8	Resolution 2.13 Å R-free 0.278
7BUM mcGAS bound with pGpA Deposited 2020-04-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–507（507 aa） Chain B 1–507（507 aa）	Not recorded	ZN ZINC ION × 2 AMP ADENOSINE MONOPHOSPHATE × 2 5GP GUANOSINE-5'-MONOPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；0.2 M Ammonium sulfate, 0.1 M MES, 30 % w/v PEG-5000 MME, pH 6.5	Resolution 3.05 Å R-free 0.280
7BUQ mcGAS bound with 23-cGAMP Deposited 2020-04-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–507（507 aa） Chain B 1–507（507 aa）	Not recorded	ZN ZINC ION × 2 1SY cGAMP × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；0.2 M Ammonium sulfate, 0.1 M BIS-Tris, 25 % w/v PEG-3350, pH 6.5	Resolution 3.09 Å R-free 0.296
7JO9 1:1 cGAS-nucleosome complex Deposited 2020-08-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 9 PDB declaration: undecameric	Chain K 142–507（366 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
7JOA 2:1 cGAS-nucleosome complex Deposited 2020-08-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 9 PDB declaration: undecameric	Chain K 142–507（366 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
7KXS Computational design of constitutively active cGAS Deposited 2020-12-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 147–507（361 aa） Chain B 147–507（361 aa）	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；20 % w/v Polyethylene glycol 3,350 200 mM Potassium thiocyanate	Resolution 2.60 Å R-free 0.261
7UTT Structure of Non-hydrolyzable ATP (ApCpp) binds to Cyclic GMP AMP synthase (cGAS) through Mn coordination Deposited 2022-04-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Not recorded	APC DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.04 Å R-free 0.210
7UUX ATP binds to Cyclic GMP AMP synthase (cGAS) through Mg coordination Deposited 2022-04-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Mutation：E211Q, D213N Mutation：E211Q, D213N	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 MG MAGNESIUM ION × 2 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.26 Å R-free 0.234
7UXW Structure of ATP and GTP bind to Cyclic GMP AMP synthase (cGAS) through Mg coordination Deposited 2022-05-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Mutation：E211Q, D213N Mutation：E211Q, D213N	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 2 MG MAGNESIUM ION × 2 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.57 Å R-free 0.248
7UYQ Structure of GTP binds to Cyclic GMP AMP synthase (cGAS) through Mg coordination Deposited 2022-05-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Mutation：E211Q, D213N Mutation：E211Q, D213N	GTP GUANOSINE-5'-TRIPHOSPHATE × 4 MG MAGNESIUM ION × 2 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.57 Å R-free 0.241
7UYZ Structure of Ternary Complex of cGAS with dsDNA and Bound 5 -pppG(2 ,5 )pG Deposited 2022-05-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Not recorded	MG MAGNESIUM ION × 4 ZN ZINC ION × 2 5GP GUANOSINE-5'-MONOPHOSPHATE × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.49 Å R-free 0.251
7UZR Structure of Ternary Complex of cGAS with dsDNA and Bound 5 -pppG(2 ,5 )pG Deposited 2022-05-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	OKR [[(2~{R},3~{R},4~{R},5~{R})-5-(2-azanyl-6-oxidanylidene-1~{H}-purin-9-yl)-4-[[(2~{R},3~{S},4~{R},5~{R})-5-(2-azanyl-6-oxidanylidene-1~{H}-purin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-3-oxidanyl-oxolan-2-yl]methoxy-oxidanyl-phosphoryl] phosphono hydrogen phosphate × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.70 Å R-free 0.245
7V0C Structure of Ternary Complex of cGAS with dsDNA and Bound 5 -pppG(2 ,5 )pG Deposited 2022-05-10	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain Chain C 147–507（361 aa） Fragment：catalytic domain	Not recorded	OKR [[(2~{R},3~{R},4~{R},5~{R})-5-(2-azanyl-6-oxidanylidene-1~{H}-purin-9-yl)-4-[[(2~{R},3~{S},4~{R},5~{R})-5-(2-azanyl-6-oxidanylidene-1~{H}-purin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-3-oxidanyl-oxolan-2-yl]methoxy-oxidanyl-phosphoryl] phosphono hydrogen phosphate × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.57 Å R-free 0.240
7V0R Structure of Ternary Complex of cGAS with dsDNA and Bound 5 -ppcpG(2 ,5 )pA Deposited 2022-05-10	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain Chain C 147–507（361 aa） Fragment：catalytic domain	Not recorded	OKX [(2~{R},3~{R},4~{R},5~{R})-4-[[(2~{R},3~{S},4~{R},5~{R})-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-5-(2-azanyl-6-oxidanylidene-1~{H}-purin-9-yl)-3-oxidanyl-oxolan-2-yl]methoxy-[[oxidanyl(phosphonooxy)phosphoryl]methyl]phosphinic acid × 2 MG MAGNESIUM ION × 4 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.51 Å R-free 0.250
7V0W Structure of Ternary Complex of cGAS with dsDNA and Bound 5 -pppG(2,5 )pA Deposited 2022-05-11	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Mutation：E211Q, D213N Mutation：E211Q, D213N	ZN ZINC ION × 2 MN MANGANESE (II) ION × 2 AMP ADENOSINE MONOPHOSPHATE × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.66 Å R-free 0.238
8EAE Structure of Ternary Complex of cGAS with dsDNA and Bound 5-pppG(2,5)pI Deposited 2022-08-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Not recorded	VLO [[(2~{R},3~{R},4~{R},5~{R})-5-(2-azanyl-6-oxidanylidene-1~{H}-purin-9-yl)-4-[[(2~{R},3~{S},4~{R},5~{R})-3,4-bis(oxidanyl)-5-(6-oxidanylidene-1~{H}-purin-9-yl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-3-oxidanyl-oxolan-2-yl]methoxy-oxidanyl-phosphoryl] phosphono hydrogen phosphate × 2 ZN ZINC ION × 2 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.56 Å R-free 0.233
8ECC Structure of Ternary Complex of cGAS with dsDNA and Bound 5-pppI(2,5)pA Deposited 2022-09-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 2 ZN ZINC ION × 2 VWX [[(2~{R},3~{R},4~{R},5~{R})-4-[[(2~{R},3~{S},4~{R},5~{R})-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-3-oxidanyl-5-(6-oxidanylidene-1~{H}-purin-9-yl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl] phosphono hydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.44 Å R-free 0.259
8G10 Structure of Ternary Complex of cGAS with dsDNA and Bound ITP and GTP Deposited 2023-02-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Mutation：E211Q, D213N Mutation：E211Q, D213N	GTP GUANOSINE-5'-TRIPHOSPHATE × 4 MG MAGNESIUM ION × 2 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate,32%MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.47 Å R-free 0.227
8G1J Structure of Ternary Complex of cGAS with dsDNA and Bound ATP and ITP Deposited 2023-02-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Mutation：E211Q, D213N Mutation：E211Q, D213N	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 2 MG MAGNESIUM ION × 2 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.30 Å R-free 0.234
8G23 Structure of Ternary Complex of cGAS with dsDNA and Bound pppIpA Deposited 2023-02-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 2 ZN ZINC ION × 2 VWX [[(2~{R},3~{R},4~{R},5~{R})-4-[[(2~{R},3~{S},4~{R},5~{R})-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-3-oxidanyl-5-(6-oxidanylidene-1~{H}-purin-9-yl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl] phosphono hydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.71 Å R-free 0.248
8G2P Structure of Ternary Complex of cGAS with dsDNA and Bound ATP and GTP Deposited 2023-02-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Mutation：D307N Mutation：D307N	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 2 MG MAGNESIUM ION × 2 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.52 Å R-free 0.242
8G2Q Structure of Ternary Complex of mouse cGAS with dsDNA and Bound GTP Deposited 2023-02-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Chain C 147–507（361 aa）	Mutation：D307N Mutation：D307N	GTP GUANOSINE-5'-TRIPHOSPHATE × 4 MG MAGNESIUM ION × 2 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.37 Å R-free 0.244
8GIM Structure of Ternary Complex of mouse cGAS with dsDNA and Bound ATP: with 10mM Mg2+ Deposited 2023-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MG MAGNESIUM ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.63 Å R-free 0.230
8GIN Structure of Ternary Complex of mouse cGAS with dsDNA and Bound ATP: with 10mM Mg2+ and 0.015mM Mn2+ Deposited 2023-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 2 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.75 Å R-free 0.225
8GIO Structure of Ternary Complex of mouse cGAS with dsDNA and Bound ATP: with 10mM Mg2+ and 0.1mM Mn2+ Deposited 2023-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.67 Å R-free 0.241
8GIP Structure of Ternary Complex of mouse cGAS with dsDNA and Bound ATP: with 10mM Mg2+ and 0.040mM Mn2+ Deposited 2023-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 MG MAGNESIUM ION × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.70 Å R-free 0.242
8GIR Structure of Ternary Complex of mouse cGAS with dsDNA and Bound ATP: with 10mM Mg2+ and 0.2mM Mn2+ Deposited 2023-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.50 Å R-free 0.229
8GIS Structure of Ternary Complex of mouse cGAS with dsDNA and Bound ATP: with 10mM Mg2+ and 0.5mM Mn2+ Deposited 2023-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.46 Å R-free 0.230
8GIT Structure of Ternary Complex of mouse cGAS with dsDNA and Bound ATP: with 10mM Mg2+ and 1mM Mn2+ Deposited 2023-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain, residues 147-507 Chain C 147–507（361 aa） Fragment：catalytic domain, residues 147-507	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, with 0.1 M Bis-Tris pH 6.5	Resolution 2.72 Å R-free 0.230
8SHK Structure of binary complex of mouse cGAS and bound ATP Deposited 2023-04-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507)	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1 ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M magnesium acetate tetrahydrate, 0.1 M sodium cacodylate trihydrate, pH 6.5, 20% w/v PEG8000	Resolution 1.71 Å R-free 0.228
8SHU Structure of mouse cGAS Deposited 2023-04-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507)	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M magnesium acetate tetrahydrate, 0.1 M sodium cacodylate trihydrate, pH 6.5, 20% w/v PEG8000	Resolution 1.71 Å R-free 0.211
8SHY Structure of binary complex of mouse cGAS QN and bound ATP Deposited 2023-04-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507)	Mutation：E211Q, D213N	ZN ZINC ION × 1 ATP ADENOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M magnesium acetate tetrahydrate, 0.1 M sodium cacodylate trihydrate, pH 6.5, 20% w/v PEG8000	Resolution 1.77 Å R-free 0.214
8SJ0 Structure of ternary complex of cGAS with dsDNA and bound 2'-dATP Deposited 2023-04-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507) Chain C 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507)	Not recorded	DTP 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, 0.1 M Bis-Tris pH 6.5	Resolution 2.55 Å R-free 0.237
8SJ1 Structure of ternary complex of cGAS with dsDNA and bound 3'-dATP Deposited 2023-04-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507) Chain C 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507)	Not recorded	3AT 3'-DEOXYADENOSINE-5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, 0.1 M Bis-Tris, pH 6.5	Resolution 2.81 Å R-free 0.240
8SJ2 Structure of ternary complex of cGAS with dsDNA and bound ATP and 2'-dGTP Deposited 2023-04-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507) Chain C 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507)	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 DGT 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE × 2 MG MAGNESIUM ION × 2 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, 0.1 M Bis-Tris, pH 6.5	Resolution 2.23 Å R-free 0.234
8SKT Structure of ternary complex of mouse cGAS with dsDNA and bound ATP with 5 mM Mn2+ Deposited 2023-04-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507) Chain C 147–507（361 aa） Fragment：catalytic domain (UNP residues 147-507)	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 ZN ZINC ION × 2 MN MANGANESE (II) ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277.15 K；0.2 M ammonium acetate, 32% MPD, 0.1 M Bis-Tris, pH 6.5	Resolution 2.69 Å R-free 0.247
9J2Z mouse cGAS catalytic domain bound with RU.521 Deposited 2024-08-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 146–507（362 aa）	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；277 K；0.1 M HEPES, 0.1 M MgAc2, 20% PEG3350	Resolution 2.39 Å R-free 0.263
9J2Z mouse cGAS catalytic domain bound with RU.521 Deposited 2024-08-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 146–507（362 aa）	Not recorded	ZN ZINC ION × 1 A1EAM (4~{S},5~{R})-2-[4,5-bis(chloranyl)-1~{H}-benzimidazol-2-yl]-5-methyl-4-[(1~{S})-3-oxidanylidene-1~{H}-2-benzofuran-1-yl]pyrazolidin-3-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；277 K；0.1 M HEPES, 0.1 M MgAc2, 20% PEG3350	Resolution 2.39 Å R-free 0.263
9J2Z mouse cGAS catalytic domain bound with RU.521 Deposited 2024-08-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 146–507（362 aa）	Not recorded	ZN ZINC ION × 1 A1EAM (4~{S},5~{R})-2-[4,5-bis(chloranyl)-1~{H}-benzimidazol-2-yl]-5-methyl-4-[(1~{S})-3-oxidanylidene-1~{H}-2-benzofuran-1-yl]pyrazolidin-3-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；277 K；0.1 M HEPES, 0.1 M MgAc2, 20% PEG3350	Resolution 2.39 Å R-free 0.263
9J2Z mouse cGAS catalytic domain bound with RU.521 Deposited 2024-08-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain D 146–507（362 aa）	Not recorded	ZN ZINC ION × 1 A1EAM (4~{S},5~{R})-2-[4,5-bis(chloranyl)-1~{H}-benzimidazol-2-yl]-5-methyl-4-[(1~{S})-3-oxidanylidene-1~{H}-2-benzofuran-1-yl]pyrazolidin-3-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.6；277 K；0.1 M HEPES, 0.1 M MgAc2, 20% PEG3350	Resolution 2.39 Å R-free 0.263
9OH4 Cryo-EM structure of cGAS tetramer in complex with BuDNA (bubble DNA) Deposited 2025-05-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: octameric	Chain A 149–505（357 aa） Fragment：UNP residues 149-505 Chain B 149–505（357 aa） Fragment：UNP residues 149-505 Chain C 149–505（357 aa） Fragment：UNP residues 149-505 Chain D 149–505（357 aa） Fragment：UNP residues 149-505	Not recorded	ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20mM Tris pH 7.5, 150mM NaCl, and 0.5mM TCEP cryo-EM vitrification conditions Cryogen ETHANE；Filter paper blotted with blot force 2 and blot time 2s, and plunge-frozen in liquid ethane using a Vitrobot Mark IV at 4 degree Celsius and 100% humidity.	Resolution 3.48 Å

55 other PDB entries and 63 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	CGAS_MOUSE
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–370； UniProt 139–507 Author chain B； PDBConstruct 2–370； UniProt 139–507 Author chain C； PDBConstruct 2–370； UniProt 139–507 Author chain D； PDBConstruct 2–370； UniProt 139–507 Author chain E； PDBConstruct 2–370； UniProt 139–507 Author chain F； PDBConstruct 2–370； UniProt 139–507

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5n6i
Deposition date deposition_date	2017-02-15
Structure title title	Crystal structure of mouse cGAS in complex with 39 bp DNA
Keywords keywords	;nucleotidyltransferase, cyclic GMP-AMP synthase, cGAS, DNA-binding, activator DNA, pattern recognition receptor, innate immune response, viral DNA recognition, TRANSFERASE ;; TRANSFERASE
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	56.96 Å
Radius of gyration Rg (electron density) rg_electron	57.78 Å
Forward intensity I(0) i0	1796210000.00
Molecular weight molecular_weight	317740.0 kDa
Excluded volume excluded_volume	382680 Å³
Envelope volume envelope_volume	580850 Å³
Hydration-shell volume shell_volume	89708 Å³
Envelope diameter envelope_diameter	196.1 Å
Shell Rg shell_rg	53.13 Å
Envelope Rg envelope_rg	56.82 Å
Shape Rg shape_rg	57.78 Å
Total Rg total_rg	57.66 Å
Total atoms total_atoms	22083
Residues n_residues	2354
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	188.7 Å
Rg (real space) rg_real	57.55 Å
Rg uncertainty (real space) rg_real_error	1.99 Å
I(0) (real space) i0_real	1.7960e+09
I(0) uncertainty (real space) i0_real_error	3.5940e+07
Rg (reciprocal space) rg_reciprocal	56.43 Å
I(0) (reciprocal space) i0_reciprocal	1793000000.0000
Solution quality estimate total_estimate	0.7748
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	47.2 Å
Skewness Skewness skewness	0.588
Kurtosis Kurtosis kurtosis	-0.395
Angular range angular_range	— – 0.1400 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	640300000.0000
Real-space data points n_real_points	29
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.705; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.899; Smooth: 0.054

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Cyclic GMP-AMP synthase
Molecular weight formula_weight	43401.2 kDa
EC 编号 ec_number	2.7.7.86
Source method src_method	man
Copy count entity_count	6

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F
Atom count atom_count	22083

GAMRGSRKEPDKLKKVLDKLRLKRKDISEAAETVNKVVERLLRRMQKRESEFKGVEQLNTGSYYEHVKISAPNEFDVMFKLEVPRIELQEYYETGAFYLVKFKRIPRGNPLSHFLEGEVLSATKMLSKFRKIIKEEVKEIKDIDVSVEKEKPGSPAVTLLIRNPEEISVDIILALESKGSWPISTKEGLPIQGWLGTKVRTNLRREPFYLVPKNAKDGNSFQGETWRLSFSHTEKYILNNHGIEKTCCESSGAKCCRKECLKLMKYLLEQLKKEFQELDAFCSYHVKTAIFHMWTQDPQDSQWDPRNLSSCFDKLLAFFLECLRTEKLDHYFIPKFNLFSQELIDRKSKEFLSKKIEYERNNGFPIFDKL

来源 Source

来源生物 organism	Mus musculus
通用名 common_name	Mouse
NCBI Class编号 ncbi_taxonomy_id	10090
宿主生物 host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	DNA (37-MER)
Molecular weight formula_weight	11987.7 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G,I,K,M

AGATCTACTAGTGATCTATGACTGATCTGTACATGATCT

Entity 3 Entity 3 polymer

Description description	DNA (36-MER)
Molecular weight formula_weight	12014.8 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H,J,L,N

AGATCATGTACAGATCAGTCATAGATCACTAGTAGATCT

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	6

▼

7. Fold Classification (SCOP + CATH) 12 domains

CATH v4.4 (12 domains)

Domain ID domain_id	5n6iA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iC01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iC02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iD01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iD02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iE01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iE02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iF01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iF02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

▶

8. Citations (1)

▶

Unit-cell length a length_a	168.530 Å
Unit-cell length b length_b	122.940 Å
Unit-cell length c length_c	179.980 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	96.37 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	24

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	3.600 Å
Low-resolution limit resolution_low	47.000 Å
R factor r_factor	0.2065
R_work r_work	0.2039
R_free r_free	0.2563

fit	/app/data/saxs_computation/n6/5n6i/5n6i.fit
pddf	/app/data/pr_computation/n6/5n6i/5n6i.pr.out
profile	/app/data/saxs_computation/n6/5n6i/5n6i.dat

Crystal structure of mouse cGAS in complex with 39 bp DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cyclic GMP-AMP synthase

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

7. Fold Classification (SCOP + CATH) 12 domains

CATH v4.4 (12 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)