SAXSdb — 5n6i

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cyclic GMP-AMP synthase

Mus musculus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 6 DNA 8	DNA (37-MER) × 4 DNA (36-MER) × 4 ZINC ION × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	CGAS_MOUSE
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–370； UniProt 139–507 Author chain B； PDBConstruct 2–370； UniProt 139–507 Author chain C； PDBConstruct 2–370； UniProt 139–507 Author chain D； PDBConstruct 2–370； UniProt 139–507 Author chain E； PDBConstruct 2–370； UniProt 139–507 Author chain F； PDBConstruct 2–370； UniProt 139–507

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5n6i
Deposition date deposition_date	2017-02-15
Structure title title	Crystal structure of mouse cGAS in complex with 39 bp DNA
Keywords keywords	;nucleotidyltransferase, cyclic GMP-AMP synthase, cGAS, DNA-binding, activator DNA, pattern recognition receptor, innate immune response, viral DNA recognition, TRANSFERASE ;; TRANSFERASE
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5n6i__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5n6i__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5n6i__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	56.96 Å
Rg (electron density)	57.78 Å
Total Rg	57.66 Å
Atom count	22083
Residues	2354
Excluded volume	382680 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5n6i__assembly_1__model_1`	tetradecameric （14）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Cyclic GMP-AMP synthase
Molecular weight formula_weight	43401.2 kDa
EC 编号 ec_number	2.7.7.86
Source method src_method	man
Copy count entity_count	6

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F
Atom count atom_count	22083

GAMRGSRKEPDKLKKVLDKLRLKRKDISEAAETVNKVVERLLRRMQKRESEFKGVEQLNTGSYYEHVKISAPNEFDVMFKLEVPRIELQEYYETGAFYLVKFKRIPRGNPLSHFLEGEVLSATKMLSKFRKIIKEEVKEIKDIDVSVEKEKPGSPAVTLLIRNPEEISVDIILALESKGSWPISTKEGLPIQGWLGTKVRTNLRREPFYLVPKNAKDGNSFQGETWRLSFSHTEKYILNNHGIEKTCCESSGAKCCRKECLKLMKYLLEQLKKEFQELDAFCSYHVKTAIFHMWTQDPQDSQWDPRNLSSCFDKLLAFFLECLRTEKLDHYFIPKFNLFSQELIDRKSKEFLSKKIEYERNNGFPIFDKL

Source Source

Source organism organism	Mus musculus
Common name common_name	Mouse
NCBI taxonomy ID ncbi_taxonomy_id	10090
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	DNA (37-MER)
Molecular weight formula_weight	11987.7 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G,I,K,M

AGATCTACTAGTGATCTATGACTGATCTGTACATGATCT

Entity 3 Entity 3 polymer

Description description	DNA (36-MER)
Molecular weight formula_weight	12014.8 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H,J,L,N

AGATCATGTACAGATCAGTCATAGATCACTAGTAGATCT

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	6

▼

6. Fold Classification (SCOP + CATH) 12 domains

CATH v4.4 (12 domains)

Domain ID domain_id	5n6iA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iC01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iC02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iD01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iD02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iE01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iE02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

Domain ID domain_id	5n6iF01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1410 — Poly(a)-polymerase, middle domain
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	5n6iF02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	460 — Beta Polymerase; domain 2
Homologous superfamily homologous superfamily	90 —

▶

Unit-cell length a length_a	168.530 Å
Unit-cell length b length_b	122.940 Å
Unit-cell length c length_c	179.980 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	96.37 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	24

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	3.600 Å
Low-resolution limit resolution_low	47.000 Å
R factor r_factor	0.2065
R_work r_work	0.2039
R_free r_free	0.2563

Crystal structure of mouse cGAS in complex with 39 bp DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cyclic GMP-AMP synthase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5n6i__assembly_1__model_1

5n6i__assembly_1__model_1 | I(q)

5n6i__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

6. Fold Classification (SCOP + CATH) 12 domains

CATH v4.4 (12 domains)

7. Citations (1)

Crystal structure of mouse cGAS in complex with 39 bp DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cyclic GMP-AMP synthase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5n6i__assembly_1__model_1

5n6i__assembly_1__model_1 | I(q)

5n6i__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

6. Fold Classification (SCOP + CATH) 12 domains

CATH v4.4 (12 domains)

7. Citations (1)