8g1i

SpCas9 with sgRNA and target DNA

Method: ELECTRON MICROSCOPY D_max: 129.9 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cas9/Csn1

Streptococcus pyogenes

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Other combination Monomer Protein × 1 DNA 2 RNA 1 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 1–1368	Not recorded	sgRNA × 1 DNA E2_TS × 1 DNA E2_NTS × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.12 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 8G1I	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
4CMP Crystal structure of S. pyogenes Cas9 Deposited 2014-01-16	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–1368（1368 aa）	Not recorded	SO4 SULFATE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS PH 8.5, 0.3 M LITHIUM SULFATE, 15% PEG 3350	Resolution 2.62 Å R-free 0.286
4CMP Crystal structure of S. pyogenes Cas9 Deposited 2014-01-16	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1–1368（1368 aa）	Not recorded	SO4 SULFATE ION × 3 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS PH 8.5, 0.3 M LITHIUM SULFATE, 15% PEG 3350	Resolution 2.62 Å R-free 0.286
4CMQ Crystal structure of Mn-bound S.pyogenes Cas9 Deposited 2014-01-17	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–1368（1368 aa）	Not recorded	MN MANGANESE (II) ION × 7 SO4 SULFATE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS 8.5, 0.3 M LITHIUM SULFATE, 15% PEG 3350 SOAKED IN MOTHER LIQUOR SUPPLEMENTED WITH 20 MM MNCL2	Resolution 3.09 Å R-free 0.277
4CMQ Crystal structure of Mn-bound S.pyogenes Cas9 Deposited 2014-01-17	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1–1368（1368 aa）	Not recorded	MN MANGANESE (II) ION × 6 SO4 SULFATE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS 8.5, 0.3 M LITHIUM SULFATE, 15% PEG 3350 SOAKED IN MOTHER LIQUOR SUPPLEMENTED WITH 20 MM MNCL2	Resolution 3.09 Å R-free 0.277
4OO8 Crystal structure of Streptococcus pyogenes Cas9 in complex with guide RNA and target DNA Deposited 2014-01-31	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–1368（1368 aa）	Mutation：D10A/C80L/H840A/C574E	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；12% PEG 3350, 100mM Tris-HCl, 200mM ammonium acetate, 150mM NaCl, 100mM NDSB-256, pH 8.0, vapor diffusion, hanging drop, temperature 293K	Resolution 2.50 Å R-free 0.254
4OO8 Crystal structure of Streptococcus pyogenes Cas9 in complex with guide RNA and target DNA Deposited 2014-01-31	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain D 1–1368（1368 aa）	Mutation：D10A/C80L/H840A/C574E	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；12% PEG 3350, 100mM Tris-HCl, 200mM ammonium acetate, 150mM NaCl, 100mM NDSB-256, pH 8.0, vapor diffusion, hanging drop, temperature 293K	Resolution 2.50 Å R-free 0.254
4UN3 Crystal structure of Cas9 bound to PAM-containing DNA target Deposited 2014-05-25	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：YES	MG MAGNESIUM ION × 8	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS-ACETATE PH 8.5, 0.3 M KSCN, 15% (W/V) PEG 3350	Resolution 2.59 Å R-free 0.252
4UN4 Crystal structure of Cas9 bound to PAM-containing DNA target with mismatches at positions 1-2 Deposited 2014-05-25	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain B 1–1368（1368 aa）	Mutation：YES	MG MAGNESIUM ION × 8	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS-ACETATE, PH 8.5, 0.3 M KSCN, 15% (W/V) PEG 3350	Resolution 2.37 Å R-free 0.248
4UN5 Crystal structure of Cas9 bound to PAM-containing DNA target containing mismatches at positions 1-3 Deposited 2014-05-25	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain B 1–1368（1368 aa）	Mutation：YES	MG MAGNESIUM ION × 8	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS-ACETATE PH 8.5, 0.3 M KSCN, 15% PEG (W/V) 3350	Resolution 2.40 Å R-free 0.246
5B2R Crystal structure of the Streptococcus pyogenes Cas9 VQR variant in complex with sgRNA and target DNA (TGA PAM) Deposited 2016-02-02	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, C80L, C574E, H840A, D1135V, R1335Q, T1337R	K POTASSIUM ION × 11 MG MAGNESIUM ION × 3 EDO 1,2-ETHANEDIOL × 4 ACT ACETATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；15-17% PEG 3350, 0.4 M KSCN, 0.1 M Tris-acetate	Resolution 2.00 Å R-free 0.230
5B2S Crystal structure of the Streptococcus pyogenes Cas9 EQR variant in complex with sgRNA and target DNA (TGAG PAM) Deposited 2016-02-02	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, C80L, C574E, H840A, D1135E, R1335Q, T1337R	K POTASSIUM ION × 11 MG MAGNESIUM ION × 3 EDO 1,2-ETHANEDIOL × 4 ACT ACETATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；15-17% PEG 3350, 0.4 M KSCN, 0.1 M Tris-acetate	Resolution 2.20 Å R-free 0.231
5B2T Crystal structure of the Streptococcus pyogenes Cas9 VRER variant in complex with sgRNA and target DNA (TGCG PAM) Deposited 2016-02-02	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, C80L, C574E, H840A, D1135V, G1218R, R1335E, T1337R	K POTASSIUM ION × 10 MG MAGNESIUM ION × 3 EDO 1,2-ETHANEDIOL × 5 ACT ACETATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；15-17% PEG 3350, 0.4 M KSCN, 0.1 M Tris-acetate	Resolution 2.20 Å R-free 0.223
5F9R Crystal structure of catalytically-active Streptococcus pyogenes CRISPR-Cas9 in complex with single-guided RNA and double-stranded DNA primed for target DNA cleavage Deposited 2015-12-10	Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Not recorded	SO4 SULFATE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；1.8 M ammonium sulfate, 100 mM Tris-HCl pH8.0 and 10 mM EDTA	Resolution 3.40 Å R-free 0.299
5FQ5 Crystal structure of Cas9-sgRNA-DNA complex solved by native SAD phasing Deposited 2015-12-07	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain B 1–1368（1368 aa）	Mutation：YES	MG MAGNESIUM ION × 2 K POTASSIUM ION × 13	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS-ACETATE PH 8.5, 0.3 M KSCN, 15% PEG (W/V) 3350	Resolution 2.14 Å R-free 0.225
5FW1 Crystal structure of SpyCas9 variant VQR bound to sgRNA and TGAG PAM target DNA Deposited 2016-02-11	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：YES	K POTASSIUM ION × 13 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS PH 8.5, 0.3 M KSCN, 15% (W/V) PEG 3400	Resolution 2.50 Å R-free 0.254
5FW2 Crystal structure of SpCas9 variant EQR bound to sgRNA and TGAG PAM target DNA Deposited 2016-02-11	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：YES	MG MAGNESIUM ION × 2 K POTASSIUM ION × 10	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS PH 8.5 0.3M KSCN 15% (W/V) PEG 3400	Resolution 2.68 Å R-free 0.231
5FW3 Crystal structure of SpCas9 variant VRER bound to sgRNA and TGCG PAM target DNA Deposited 2016-02-11	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：YES	MG MAGNESIUM ION × 2 K POTASSIUM ION × 11	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；0.1 M TRIS PH 8.5 0.3M KSCN 15% (W/V) PEG 3400	Resolution 2.70 Å R-free 0.242
5VW1 Crystal structure of SpyCas9-sgRNA-AcrIIA4 ternary complex Deposited 2017-05-21	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1368（1368 aa）	Mutation：D10A/H840A	PEG DI(HYDROXYETHYL)ETHER × 2 PG4 TETRAETHYLENE GLYCOL × 2 EDO 1,2-ETHANEDIOL × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions EVAPORATION；pH 7.2；293 K；0.1 M HEPES (pH 7.5), and 15% PEG3350 (v/v)	Resolution 2.60 Å R-free 0.226
5XBL Structure of nuclease in complex with associated protein Deposited 2017-03-20	Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.1 M Tris-HCl, pH 6.5, 0.2 M MgCl2 and 14% (w/v) Polyethylene glycol (PEG) 4000	Resolution 3.05 Å R-free 0.277
5Y36 Cryo-EM structure of SpCas9-sgRNA-DNA ternary complex Deposited 2017-07-27	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20mM Tris-Cl (pH 7.5), 100mM KCl, 5mM MgCl2, 1mM DTT cryo-EM vitrification conditions Cryogen ETHANE；blot for 4 seconds before pluging	Resolution 5.20 Å
6AEB Crystal structure of xCas9 in complex with sgRNA and target DNA (AAG PAM) Deposited 2018-08-04	Different mutation/modification Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, A263T, R324L, S409I, E480K, E543D, M694I, H840A, E1219V	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.1M Hepes, PH 7.5, 0.2M Ammonium sulfate, 10% ispropanol, and 16% (w/v) PEG4000	Resolution 3.00 Å R-free 0.283
6AEB Crystal structure of xCas9 in complex with sgRNA and target DNA (AAG PAM) Deposited 2018-08-04	Different mutation/modification Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain F 1–1368（1368 aa）	Mutation：D10A, A263T, R324L, S409I, E480K, E543D, M694I, H840A, E1219V	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.1M Hepes, PH 7.5, 0.2M Ammonium sulfate, 10% ispropanol, and 16% (w/v) PEG4000	Resolution 3.00 Å R-free 0.283
6AEG Crystal structure of xCas9 in complex with sgRNA and target DNA (GAT PAM) Deposited 2018-08-04	Different mutation/modification Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, A263T, R324L, S409I, E480K, E543D, M694I, H840A, E1219V	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.1M Hepes, pH 7.5, 0.2M Ammonium sulfate, 10% ispropanol, 16% (w/v) PEG4000, 30%(v/v) (+/-)-2-Methyl-2,4-pentanediol	Resolution 2.70 Å R-free 0.263
6AI6 Crystal structure of SpCas9-NG Deposited 2018-08-21	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：N863A, L1111R, D1135V, G1218R, E1219F, A1322R, R1355V, T1357R	K POTASSIUM ION × 10 MG MAGNESIUM ION × 3 EDO 1,2-ETHANEDIOL × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；Tris-acetate, pH 8.0, KSCN, PEG 3350	Resolution 2.70 Å R-free 0.243
6IFO Crystal structure of AcrIIA2-SpyCas9-sgRNA ternary complex Deposited 2018-09-20	Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；289 K；0.1 M Bis-Tris, pH 6.0, 15% PEG 20000	Resolution 3.31 Å R-free 0.268
6IFO Crystal structure of AcrIIA2-SpyCas9-sgRNA ternary complex Deposited 2018-09-20	Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain B 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；289 K；0.1 M Bis-Tris, pH 6.0, 15% PEG 20000	Resolution 3.31 Å R-free 0.268
6K3Z Crystal structure of dCas9 in complex with sgRNA and DNA (TGA PAM) Deposited 2019-05-22	Different mutation/modification Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：H840A, D10A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；289 K；0.2M Ammonium phosphate dibasic, 20%(w/v) Polyethylene glycol 3,350	Resolution 3.20 Å R-free 0.276
6K4P Crystal structure of xCas9 in complex with sgRNA and DNA (TGG PAM) Deposited 2019-05-25	Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Not recorded	PO4 PHOSPHATE ION × 5	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；289 K；0.2M Ammonium phosphate dibasic, 20%(w/v) Polyethylene glycol 3,350	Resolution 2.90 Å R-free 0.269
6K4Q Crystal structure of xCas9 in complex with sgRNA and DNA (CGG PAM) Deposited 2019-05-26	Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Not recorded	PO4 PHOSPHATE ION × 9	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；289 K；0.2M Ammonium phosphate dibasic, 20%(w/v) Polyethylene glycol 3,350	Resolution 2.70 Å R-free 0.275
6K4S Crystal structure of xCas9 in complex with sgRNA and DNA (TGC PAM) Deposited 2019-05-26	Different mutation/modification Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, C80L, A262T, R324L, S409T, E480K, E543D, C574E, M694I, H840A, E1219V	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；289 K；0.2 M Ammonium phosphate dibasic, 20% w/v Polyethylene glycol 3,350	Resolution 3.01 Å R-free 0.285
6K4U Crystal structure of xCas9 in complex with sgRNA and DNA (TGA PAM) Deposited 2019-05-27	Different mutation/modification Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, A262T, R324L, S409T, E480K, E543D, M694I, H840A, E1219V	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；289 K；0.2 M Ammonium phosphate dibasic, 20% w/v Polyethylene glycol 3,350	Resolution 3.20 Å R-free 0.282
6K57 Crystal structure of dCas9 in complex with sgRNA and DNA (CGA PAM) Deposited 2019-05-28	Different mutation/modification Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；289 K；0.2M Ammonium phosphate dibasic, 20%(w/v) Polyethylene glycol 3,350	Resolution 2.98 Å R-free 0.274
6O0X Conformational states of Cas9-sgRNA-DNA ternary complex in the presence of magnesium Deposited 2019-02-17	Different oligomeric state Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.28 Å
6O0Y Conformational states of Cas9-sgRNA-DNA ternary complex in the presence of magnesium Deposited 2019-02-17	Different oligomeric state Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.37 Å
6O0Z Conformational states of Cas9-sgRNA-DNA ternary complex in the presence of magnesium Deposited 2019-02-17	Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
6O56 HNH Nuclease from S. pyogenes Cas9 Deposited 2019-03-01	Different construct Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 775–908（134 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；0.1 M [imidazole and MES] pH 6.5, 25% (v/v) [2-methyl-2,4-pentanediol, PEG1000, and PEG3350], 0.3 M [diethylene glycol, triethylene glycol, tetraethylene glycol, pentaethlyene glycol]	Resolution 1.90 Å R-free 0.253
6O56 HNH Nuclease from S. pyogenes Cas9 Deposited 2019-03-01	Different construct Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 775–908（134 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；0.1 M [imidazole and MES] pH 6.5, 25% (v/v) [2-methyl-2,4-pentanediol, PEG1000, and PEG3350], 0.3 M [diethylene glycol, triethylene glycol, tetraethylene glycol, pentaethlyene glycol]	Resolution 1.90 Å R-free 0.253
7OX7 Target-bound SpCas9 complex with TRAC chimeric RNA-DNA guide Deposited 2021-06-22	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 14	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.60 Å R-free 0.229
7OX8 Target-bound SpCas9 complex with TRAC full RNA guide Deposited 2021-06-22	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 12	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.75 Å R-free 0.248
7OX9 Target-bound SpCas9 complex with AAVS1 all-RNA guide Deposited 2021-06-22	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 11	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.45 Å R-free 0.233
7OXA Target-bound SpCas9 complex with AAVS1 chimeric RNA-DNA guide Deposited 2021-06-22	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 14	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.15 Å R-free 0.226
7QQO SpCas9 bound to AAVS1 off-target1 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 12	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 3.00 Å R-free 0.247
7QQP SpCas9 bound to AAVS1 off-target3 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 10 EDO 1,2-ETHANEDIOL × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.60 Å R-free 0.225
7QQQ SpCas9 bound to AAVS1 off-target4 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 13 EDO 1,2-ETHANEDIOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.65 Å R-free 0.235
7QQR SpCas9 bound to AAVS1 off-target5 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 13 EDO 1,2-ETHANEDIOL × 5	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.75 Å R-free 0.231
7QQS SpCas9 bound to FANCF on-target DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 10	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.40 Å R-free 0.229
7QQT SpCas9 bound to FANCF off-target1 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 10	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.50 Å R-free 0.238
7QQU SpCas9 bound to FANCF off-target2 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 13	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.45 Å R-free 0.231
7QQV SpCas9 bound to FANCF off-target3 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 10	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.25 Å R-free 0.230
7QQW SpCas9 bound to FANCF off-target4 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 10	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 3.10 Å R-free 0.234
7QQX SpCas9 bound to FANCF off-target5 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 9	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.40 Å R-free 0.216
7QQZ SpCas9 bound to FANCF off-target7 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 11	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.25 Å R-free 0.247
7QR0 SpCas9 bound to TRAC off-target1 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 17	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.30 Å R-free 0.224
7QR1 SpCas9 bound to TRAC off-target2 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 14	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.60 Å R-free 0.231
7QR5 SpCas9 bound to FANCF off-target6 DNA substrate Deposited 2022-01-17	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 11 EDO 1,2-ETHANEDIOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 3.30 Å R-free 0.254
7QR7 SpCas9 bound to AAVS1 off-target2 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 13	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 3.00 Å R-free 0.245
7QR8 SpCas9 bound to PTPRC off-target1 DNA substrate Deposited 2022-01-10	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 10	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.75 Å R-free 0.250
7S36 Cas9:sgRNA:DNA (S. pyogenes) with 0 RNA:DNA base pairs, closed-protein/bent-DNA conformation Deposited 2021-09-04	Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain P 1–1368（1368 aa）	Mutation：T1337C	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
7S37 Cas9:sgRNA (S. pyogenes) in the open-protein conformation Deposited 2021-09-04	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain P 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
7S38 Cas9:sgRNA:DNA (S. pyogenes) forming a 3-base-pair R-loop Deposited 2021-09-04	Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain P 1–1368（1368 aa）	Mutation：T1337C	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
7S3H Cas9:sgRNA:DNA (S. pyogenes) with 0 RNA:DNA base pairs, open-protein/linear-DNA conformation Deposited 2021-09-06	Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain P 1–1368（1368 aa）	Mutation：T1337C	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.50 Å
7S4U Cryo-EM structure of Cas9 in complex with 12-14MM DNA substrate, 5 minute time-point Deposited 2021-09-09	Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.56 Å
7S4V Cas9 bound to 12-14MM DNA, 60 min time-point, kinked conformation Deposited 2021-09-09	Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.28 Å
7S4X Cas9:gRNA in complex with 18-20MM DNA, 1 minute time-point, kinked active conformation Deposited 2021-09-09	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 1–1368（1368 aa）	Not recorded	MG MAGNESIUM ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.76 Å
7V59 Cryo-EM structure of spyCas9-sgRNA-DNA dimer Deposited 2021-08-16	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Other combination Homooligomer；Protein × 2 PDB declaration: hexameric	Chain B 3–1364（1362 aa） Chain E 3–1364（1362 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 5.26 Å
7VK9 Crystal structure of xCas9 P411T Deposited 2021-09-29	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–1368（1368 aa）	Mutation：P411T,R324L,S409I,E480K,A262T,E543D,M694I,E1219V	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；0.1M Sodium Cacodylate pH 7.0, 1M Sodium citrate tribasic dehydrate	Resolution 2.90 Å R-free 0.234
7Z4C SpCas9 bound to 6 nucleotide complementary DNA substrate Deposited 2022-03-03	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10, H840	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.87 Å
7Z4D Crystal structure of SpCas9 bound to a 10 nucleotide complementary DNA substrate Deposited 2022-03-03	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	K POTASSIUM ION × 10	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293.15 K；0.1 M sodium cacodylate pH 6.5, 0.8-1.2M ammonium formate, 12-14% PEG4000	Resolution 3.10 Å R-free 0.276
7Z4D Crystal structure of SpCas9 bound to a 10 nucleotide complementary DNA substrate Deposited 2022-03-03	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain E 1–1368（1368 aa）	Mutation：D10A, H840A	K POTASSIUM ION × 6	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；293.15 K；0.1 M sodium cacodylate pH 6.5, 0.8-1.2M ammonium formate, 12-14% PEG4000	Resolution 3.10 Å R-free 0.276
7Z4E SpCas9 bound to 8-nucleotide complementary DNA substrate Deposited 2022-03-03	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 4.14 Å
7Z4G SpCas9 bound to 12-nucleotide complementary DNA substrate Deposited 2022-03-03	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.64 Å
7Z4H SpCas9 bound to 14-nucleotide complementary DNA substrate Deposited 2022-03-03	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.49 Å
7Z4I SpCas9 bound to 16-nucleotide complementary DNA substrate Deposited 2022-03-03	Different mutation/modification Different ligand/ion Different experimental conditions	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.12 Å
7Z4J SpCas9 bound to 18-nucleotide complementary DNA substrate in the catalytic state Deposited 2022-03-03	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain B 1–1368（1368 aa）	Not recorded	MG MAGNESIUM ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 2.99 Å
7Z4K SpCas9 bound to 10-nucleotide complementary DNA substrate Deposited 2022-03-04	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.81 Å
7Z4L SpCas9 bound to 18-nucleotide complementary DNA substrate in the checkpoint state Deposited 2022-03-04	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Not recorded	MG MAGNESIUM ION × 1 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 2.54 Å
7ZO1 SpCas9 bound to CD34 off-target9 DNA substrate Deposited 2022-04-23	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Mutation：D10A, H840A	MG MAGNESIUM ION × 2 K POTASSIUM ION × 8	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293.15 K；0.1 M Tris-acetate pH 8.5, 0.3-0.5 M KSCN, 17-19% PEG3350	Resolution 2.40 Å R-free 0.250
8FZT SpCas9 with dual-guide RNA and target DNA Deposited 2023-01-30	Different oligomeric state Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain E 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.03 Å
8KAG Crystal structure of SpyCas9 in complex with sgRNA and target RNA Deposited 2023-08-03	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 1–1368（1368 aa）	Mutation：A10D,A840H	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；1.7 M Ammonium citrate tribasic, 0.1 M HEPES pH 7.0	Resolution 3.88 Å R-free 0.320
8KAH Crystal structure of SpyCas9-crRNA-tracrRNA complex bound to 18nt target DNA Deposited 2023-08-03	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain B 1–1368（1368 aa）	Mutation：A10D,A840H	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；1.0 M Sodium chloride, 0.1 M Sodium citrate pH 6.0, 13.25% PEG4000	Resolution 3.36 Å R-free 0.255
8KAH Crystal structure of SpyCas9-crRNA-tracrRNA complex bound to 18nt target DNA Deposited 2023-08-03	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain F 1–1368（1368 aa）	Mutation：A10D,A840H	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；1.0 M Sodium chloride, 0.1 M Sodium citrate pH 6.0, 13.25% PEG4000	Resolution 3.36 Å R-free 0.255
8KAI Crystal structure of SpyCas9-crRNA-tracrRNA complex bound to 17nt target DNA Deposited 2023-08-03	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain B 1–1368（1368 aa）	Mutation：A10D,A840H	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；1.0 M Sodium chloride, 0.1 M Sodium citrate pH 6.0, 13% PEG4000	Resolution 3.49 Å R-free 0.294
8KAI Crystal structure of SpyCas9-crRNA-tracrRNA complex bound to 17nt target DNA Deposited 2023-08-03	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain F 1–1368（1368 aa）	Mutation：A10D,A840H	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；1.0 M Sodium chloride, 0.1 M Sodium citrate pH 6.0, 13% PEG4000	Resolution 3.49 Å R-free 0.294
8KAJ Crystal structure of SpyCas9-crRNA-tracrRNA complex bound to 16nt target DNA Deposited 2023-08-03	Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain B 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；1.0 M Sodium chloride, 0.1 M Sodium citrate pH 6.0, 12.75% PEG4000	Resolution 3.42 Å R-free 0.246
8KAJ Crystal structure of SpyCas9-crRNA-tracrRNA complex bound to 16nt target DNA Deposited 2023-08-03	Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain F 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；1.0 M Sodium chloride, 0.1 M Sodium citrate pH 6.0, 12.75% PEG4000	Resolution 3.42 Å R-free 0.246
8KAK Crystal structure of SpyCas9 in complex with sgRNA and 18nt target DNA Deposited 2023-08-03	Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Not recorded	SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；0.15 M Ammonium sulfate, 0.1 M MES pH 6.0, 14.75% PEG4000	Resolution 3.60 Å R-free 0.297
8KAK Crystal structure of SpyCas9 in complex with sgRNA and 18nt target DNA Deposited 2023-08-03	Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain F 1–1368（1368 aa）	Not recorded	SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；0.15 M Ammonium sulfate, 0.1 M MES pH 6.0, 14.75% PEG4000	Resolution 3.60 Å R-free 0.297
8KAL Crystal structure of SpyCas9 in complex with sgRNA and 17nt target DNA Deposited 2023-08-03	Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Not recorded	SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；0.2 M Ammonium sulfate, 0.1 M MES pH 6.0, 12.625% PEG8000	Resolution 3.16 Å R-free 0.288
8KAL Crystal structure of SpyCas9 in complex with sgRNA and 17nt target DNA Deposited 2023-08-03	Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain G 1–1368（1368 aa）	Not recorded	SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；0.2 M Ammonium sulfate, 0.1 M MES pH 6.0, 12.625% PEG8000	Resolution 3.16 Å R-free 0.288
8KAM Crystal structure of SpyCas9 in complex with sgRNA and 16nt target DNA Deposited 2023-08-03	Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；0.15 M Ammonium sulfate, 0.1 M MES pH 6.0, 14.75% PEG4000	Resolution 3.91 Å R-free 0.290
8SCA Rec3 Domain from S. pyogenes Cas9 Deposited 2023-04-05	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 497–713（217 aa）	Not recorded	EDO 1,2-ETHANEDIOL × 5	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；298 K；0.1 M Bis-Tris pH 5.5, 0.2 M sodium chloride, 25% PEG3350	Resolution 1.67 Å R-free 0.209
8SPQ SpRY-Cas9:gRNA complex targeting TGG PAM DNA Deposited 2023-05-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 2–1368（1367 aa）	Mutation：A61R,L1111R,D1135L,S1136W,G1218K,E1219Q,N1317R,A1322R R1333P,R1335Q,T1337R	MG MAGNESIUM ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.26 Å
8SQH SpRY-Cas9:gRNA complex targeting TTC PAM DNA Deposited 2023-05-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	MG MAGNESIUM ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.69 Å
8SRS SpRY-Cas9:gRNA complex targeting TAC PAM DNA Deposited 2023-05-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 2–1368（1367 aa）	Mutation：A61R,L1111R,D1135L,S1136W,G1218K,E1219Q,N1317R,A1322R R1333P,R1335Q,T1337R	MG MAGNESIUM ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.79 Å
8T6O SpRY-Cas9:gRNA complex targeting TAC PAM DNA with 0 bp R-loop Deposited 2023-06-16	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R,L1111R,D1135L,S1136W,G1218K,E1219Q,N1317R,A1322R R1333P,R1335Q,T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
8T6P SpRY-Cas9:gRNA complex targeting TAC PAM DNA with 2 bp R-loop Deposited 2023-06-16	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.15 Å
8T6S SpRY-Cas9:gRNA complex targeting TAC PAM DNA with 10 bp R-loop Deposited 2023-06-18	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.28 Å
8T6T SpRY-Cas9:gRNA complex targeting TAC PAM DNA with 13 bp R-loop Deposited 2023-06-18	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.04 Å
8T6X SpRY-Cas9:gRNA complex targeting TAC PAM DNA with 18 bp R-loop Deposited 2023-06-19	Different construct Different mutation/modification Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	MG MAGNESIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.08 Å
8T6Y SpRY-Cas9:gRNA complex bound to non-target DNA with 1 bp R-loop Deposited 2023-06-19	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.88 Å
8T76 SpRY-Cas9:gRNA complex targeting TAC PAM DNA with 3 bp R-loop Deposited 2023-06-19	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.42 Å
8T77 SpRY-Cas9:gRNA complex bound to non-target DNA with 6 bp R-loop Deposited 2023-06-19	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.25 Å
8T78 SpRY-Cas9:gRNA complex bound to non-target DNA with 8 bp R-loop Deposited 2023-06-19	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.02 Å
8T79 SpRY-Cas9:gRNA complex bound to non-target DNA with 10 bp R-loop Deposited 2023-06-20	Different construct Different mutation/modification Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 3–1366（1364 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.04 Å
8T7S SpRYmer bound to NAC PAM DNA Deposited 2023-06-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Homooligomer；Protein × 2 PDB declaration: heptameric	Chain A 2–1368（1367 aa） Chain G 2–1368（1367 aa）	Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R Mutation：A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, T1337R	MG MAGNESIUM ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.01 Å
8TZZ SpG Cas9 with NGC PAM DNA target Deposited 2023-08-28	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 2–1367（1366 aa）	Not recorded	MG MAGNESIUM ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.56 Å
8U3Y SpG Cas9 with NGG PAM DNA target Deposited 2023-09-08	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 3–1366（1364 aa）	Not recorded	MG MAGNESIUM ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
8WUS SpCas9-MMLV RT-pegRNA-target DNA complex (termination) Deposited 2023-10-21	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 2 PDB declaration: hexameric	Chain A 2–1368（1367 aa）	Mutation：H10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8WUT SpCas9-MMLV RT-pegRNA-target DNA complex (initiation) Deposited 2023-10-21	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 2 PDB declaration: hexameric	Chain A 2–1368（1367 aa）	Mutation：D10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
8WUU SpCas9-pegRNA-target DNA complex (pre-initiation) Deposited 2023-10-21	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 2–1368（1367 aa）	Mutation：D10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
8WUV SpCas9-MMLV RT-pegRNA-target DNA complex (elongation 16-nt) Deposited 2023-10-21	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 2 PDB declaration: hexameric	Chain A 2–1368（1367 aa）	Mutation：D10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
8YE6 Cryo-EM structure of Cas9-sgRNA-A32 complex Deposited 2024-02-22	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen NITROGEN	Resolution 2.95 Å
8YE9 Cryo-EM structure of Cas9-sgRNA-A25 complex Deposited 2024-02-22	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen NITROGEN	Resolution 3.43 Å
8YGJ SpCas9-MMLV RT-pegRNA-target DNA complex (elongation 28-nt) Deposited 2024-02-26	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 2 PDB declaration: hexameric	Chain A 2–1368（1367 aa）	Mutation：H10A, H840A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
8YNY Structure of Cas9-sgRNA ribonucleoprotein bound to nucleosome Deposited 2024-03-12	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 9 PDB declaration: 13-meric	Chain X 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.52 Å
9B2K SpCas9 with dual-guide RNA in open conformation Deposited 2024-03-15	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain P 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.67 Å
9C9P Cas9 ternary complex, 14-nt sgRNA, State I (linear) Deposited 2024-06-14	Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
9CGU Cas9 ternary complex, 14-nt sgRNA, State II (kinked) Deposited 2024-07-01	Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
9EAK SpCas9 with 17-bp R-loop containing 2 terminal mismatches (State I - pre-activation) Deposited 2024-11-11	Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.76 Å
9EAL SpCas9 with 17-bp R-loop containing 2 terminal mismatches (State II - precleavage) Deposited 2024-11-11	Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.83 Å
9ED9 SpCas9 with 17-bp R-loop containing 2 terminal mismatches (State III - checkpoint) Deposited 2024-11-16	Different oligomeric state Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.95 Å
9EDA SpCas9 with 17-bp R-loop containing 2 terminal mismatches (State IV - product) Deposited 2024-11-16	Different oligomeric state Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.88 Å
9EDB SpCas9 with 17-bp R-loop containing 2 terminal mismatches (State V - dissociated) Deposited 2024-11-16	Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
9H4J dCas9 bound to on-target EMX1-1 (-)SC DNA minicircle Deposited 2024-10-20	Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
9H4K dCas9 bound to off-target 1 EMX1-1 (-)SC DNA minicircle Deposited 2024-10-20	Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.60 Å
9H4L dCas9 bound to off-target 2 EMX1-1 (-)SC DNA minicircle Deposited 2024-10-20	Different construct Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1366（1365 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
9H4M wtCas9 bound to off-target 1 EMX1-1 (-)SC DNA minicircle Deposited 2024-10-20	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.80 Å
9JL1 SpCas9 with mini-gRNA conformation Deposited 2024-09-17	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.50 Å
9JL2 Classical conformation for the spCas9 with gRNA and target DNA complex Deposited 2024-09-17	Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
9JL4 Apo-spCas9 conformation Deposited 2024-09-17	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.00 Å
9K4C SuperFi Cas9 - 22nt sgRNA - DNA ternary complex Deposited 2024-10-21	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.84 Å
9K4D SuperFi Cas9 - 20nt sgRNA - DNA ternary complex Deposited 2024-10-21	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.53 Å
9K4E SuperFi Cas9 - mismatch 22nt sgRNA - DNA ternary complex class1 Deposited 2024-10-21	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
9K4F SuperFi Cas9 - mismatch 22nt sgRNA - DNA ternary complex class2 Deposited 2024-10-21	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.27 Å
9K4H SuperFi Cas9 - mismatch 22nt sgRNA - DNA ternary complex class3 Deposited 2024-10-21	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.36 Å
9KJ6 Crystal Structure of SpCas9 ternary complex, amino acids (1242-1263) replaced with Gly-Ser linker Deposited 2024-11-12	Different construct Different mutation/modification Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1241（1241 aa） Chain A 1264–1368（105 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；295.15 K；0.07 M HEPES (pH 7.5), 0.18 M potassium acetate, 14% (v/v) PEG 3350	Resolution 3.59 Å R-free 0.271
9LKJ Structure of Cas9-sgRNA-A27 Deposited 2025-01-16	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain C 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7 cryo-EM vitrification conditions Cryogen NITROGEN	Resolution 2.68 Å
9W7Q SuperFi Cas9 - 20nt sgRNA - DNA ternary complex Class A Deposited 2025-08-06	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.79 Å
9W7T SuperFi Cas9 - 20nt sgRNA - DNA ternary complex Class B Deposited 2025-08-06	Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.91 Å
9W7U SuperFi Cas9 - 20nt sgRNA - DNA ternary complex Class C Deposited 2025-08-06	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.83 Å
9W7V SuperFi Cas9 - 20nt sgRNA - DNA ternary complex Class D Deposited 2025-08-07	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.81 Å
9W9D SuperFi Cas9 - 22nt sgRNA - DNA ternary complex Deposited 2025-08-09	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.40 Å
9WA9 SuperFi Cas9 - 22nt sgRNA - DNA ternary complex Class B Deposited 2025-08-11	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.12 Å
9WAA SuperFi Cas9 - 22nt sgRNA - DNA ternary complex Class C Deposited 2025-08-11	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.17 Å
9WAW SuperFi Cas9 - 20nt sgRNA - DNA ternary complex Class E Deposited 2025-08-12	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1368（1368 aa）	Mutation：Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.95 Å
9ZQ6 Structure of SpyCas9 in complex with the anti-CRISPR protein AcrIIA26 Deposited 2025-12-17	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1368（1368 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.98 Å

134 other PDB entries and 146 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	CAS9_STRP1
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–1368； UniProt 1–1368

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8g1i
Deposition date deposition_date	2023-02-02
Structure title title	SpCas9 with sgRNA and target DNA
Keywords keywords	Cas9, RNA, DNA, HYDROLASE; HYDROLASE
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	40.87 Å
Radius of gyration Rg (electron density) rg_electron	40.55 Å
Forward intensity I(0) i0	755920000.00
Molecular weight molecular_weight	195780.0 kDa
Excluded volume excluded_volume	232920 Å³
Envelope volume envelope_volume	372080 Å³
Hydration-shell volume shell_volume	74738 Å³
Envelope diameter envelope_diameter	137.4 Å
Shell Rg shell_rg	47.92 Å
Envelope Rg envelope_rg	39.21 Å
Shape Rg shape_rg	40.56 Å
Total Rg total_rg	40.90 Å
Total atoms total_atoms	13613
Residues n_residues	1440
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	129.9 Å
Rg (real space) rg_real	40.70 Å
Rg uncertainty (real space) rg_real_error	0.80 Å
I(0) (real space) i0_real	7.5590e+08
I(0) uncertainty (real space) i0_real_error	1.1950e+07
Rg (reciprocal space) rg_reciprocal	40.87 Å
I(0) (reciprocal space) i0_reciprocal	756100000.0000
Solution quality estimate total_estimate	0.8938
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	50.0 Å
Skewness Skewness skewness	0.176
Kurtosis Kurtosis kurtosis	-0.451
Angular range angular_range	— – 0.1950 Å⁻¹
Current regularization parameter α current_alpha	0.0001
Highest regularization parameter α highest_alpha	87420000.0000
Real-space data points n_real_points	40
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.898; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.987; Smooth: 0.935

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	sgRNA
Molecular weight formula_weight	31543.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	13613

UACCAGCAAAACACUCCGAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU

Entity 2 Entity 2 polymer

Description description	CRISPR-associated endonuclease Cas9/Csn1
Molecular weight formula_weight	160774.3 kDa
EC 编号 ec_number	3.1.-.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MDKKYSIGLDIGTNSVGWAVITDEYKVPSKKFKVLGNTDRHSIKKNLIGALLFDSGETAEATRLKRTARRRYTRRKNRICYLQEIFSNEMAKVDDSFFHRLEESFLVEEDKKHERHPIFGNIVDEVAYHEKYPTIYHLRKKLVDSTDKADLRLIYLALAHMIKFRGHFLIEGDLNPDNSDVDKLFIQLVQTYNQLFEENPINASGVDAKAILSARLSKSRRLENLIAQLPGEKKNGLFGNLIALSLGLTPNFKSNFDLAEDAKLQLSKDTYDDDLDNLLAQIGDQYADLFLAAKNLSDAILLSDILRVNTEITKAPLSASMIKRYDEHHQDLTLLKALVRQQLPEKYKEIFFDQSKNGYAGYIDGGASQEEFYKFIKPILEKMDGTEELLVKLNREDLLRKQRTFDNGSIPHQIHLGELHAILRRQEDFYPFLKDNREKIEKILTFRIPYYVGPLARGNSRFAWMTRKSEETITPWNFEEVVDKGASAQSFIERMTNFDKNLPNEKVLPKHSLLYEYFTVYNELTKVKYVTEGMRKPAFLSGEQKKAIVDLLFKTNRKVTVKQLKEDYFKKIECFDSVEISGVEDRFNASLGTYHDLLKIIKDKDFLDNEENEDILEDIVLTLTLFEDREMIEERLKTYAHLFDDKVMKQLKRRRYTGWGRLSRKLINGIRDKQSGKTILDFLKSDGFANRNFMQLIHDDSLTFKEDIQKAQVSGQGDSLHEHIANLAGSPAIKKGILQTVKVVDELVKVMGRHKPENIVIEMARENQTTQKGQKNSRERMKRIEEGIKELGSQILKEHPVENTQLQNEKLYLYYLQNGRDMYVDQELDINRLSDYDVDHIVPQSFLKDDSIDNKVLTRSDKNRGKSDNVPSEEVVKKMKNYWRQLLNAKLITQRKFDNLTKAERGGLSELDKAGFIKRQLVETRQITKHVAQILDSRMNTKYDENDKLIREVKVITLKSKLVSDFRKDFQFYKVREINNYHHAHDAYLNAVVGTALIKKYPKLESEFVYGDYKVYDVRKMIAKSEQEIGKATAKYFFYSNIMNFFKTEITLANGEIRKRPLIETNGETGEIVWDKGRDFATVRKVLSMPQVNIVKKTEVQTGGFSKESILPKRNSDKLIARKKDWDPKKYGGFDSPTVAYSVLVVAKVEKGKSKKLKSVKELLGITIMERSSFEKNPIDFLEAKGYKEVKKDLIIKLPKYSLFELENGRKRMLASAGELQKGNELALPSKYVNFLYLASHYEKLKGSPEDNEQKQLFVEQHKHYLDEIIEQISEFSKRVILADANLDKVLSAYNKHRDKPIREQAENIIHLFTLTNLGAPAAFKYFDTTIDRKRYTSTKEVLDATLIHQSITGLYETRIDLSQLGGDPKKKRKVMDKHHHHHH

来源 Source

来源生物 organism	Streptococcus pyogenes
NCBI Class编号 ncbi_taxonomy_id	1314
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA E2_TS
Molecular weight formula_weight	12334.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

CTAATCGCCAATCGGAGTGTTTTGCTGGTATACGCACTGG

Entity 4 Entity 4 polymer

Description description	DNA E2_NTS
Molecular weight formula_weight	12290.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CCAGTGCGTATACCAGCAAAACACTCCGATTGGCGATTAG

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.12 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	64788

fit	/app/data/saxs_computation/g1/8g1i/8g1i.fit
pddf	/app/data/pr_computation/g1/8g1i/8g1i.pr.out
profile	/app/data/saxs_computation/g1/8g1i/8g1i.dat

SpCas9 with sgRNA and target DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cas9/Csn1

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)