SAXSdb — 8poh

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Polymerase acidic protein

Influenza A virus (A/Zhejiang/DTID-ZJU01/2013(H7N9))

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 6 RNA 4	RNA-directed RNA polymerase catalytic subunit × 2 （M9TLW3） Polymerase basic protein 2 × 2 （X5F427） 51-mer vRNA loop (v51_mut_S) × 4 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	M9TI86_9INFA
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 14–729； UniProt 1–716 Author chain E； PDBConstruct 14–729； UniProt 1–716

RNA-directed RNA polymerase catalytic subunit

Influenza A virus (A/Zhejiang/DTID-ZJU01/2013(H7N9))

UniProt M9TLW3

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 6 RNA 4	Polymerase acidic protein × 2 （M9TI86） Polymerase basic protein 2 × 2 （X5F427） 51-mer vRNA loop (v51_mut_S) × 4 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	M9TLW3_9INFA
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–757； UniProt 1–757 Author chain F； PDBConstruct 1–757； UniProt 1–757

Polymerase basic protein 2

Influenza A virus (A/Zhejiang/DTID-ZJU01/2013(H7N9))

UniProt X5F427

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 6 RNA 4	Polymerase acidic protein × 2 （M9TI86） RNA-directed RNA polymerase catalytic subunit × 2 （M9TLW3） 51-mer vRNA loop (v51_mut_S) × 4 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	X5F427_9INFA
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 1–759； UniProt 1–759 Author chain G； PDBConstruct 1–759； UniProt 1–759

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8poh
Deposition date deposition_date	2023-07-04
Last revision last_revision	2024-02-21
Structure title title	Influenza A/H7N9 polymerase symmetric dimer bound to the promoter (PA K289A/C489R)
Keywords keywords	Viral polymerase, VIRAL PROTEIN; VIRAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8poh__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8poh__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8poh__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	53.97 Å
Rg (electron density)	54.68 Å
Total Rg	54.53 Å
Atom count	20693
Residues	2517
Excluded volume	365620 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8poh__assembly_1__model_1`	decameric （10）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Polymerase acidic protein
Molecular weight formula_weight	84394.1 kDa
Mutation mutation	K289A; C489R
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,E
Atom count atom_count	20729

MHHHHHHHHGSGSMEDFVRQCFNPMIVELAEKAMKEYGEDPKIETNKFASICTHLEVCFMYSDFHFIDERGESTIIESGDPNVLLKHRFEIIEGRDRTMAWTVVNSICNTTGVEKPKFLPDLYDYKENRFIEIGVTRREVHIYYLEKANKIKSEKTHIHIFSFTGEEMATKADYTLDEESRARIKTRLFTIRQEMASRGLWDSFRQSERGEETIEERFEITGTMRRLADQSLPPNFSSLENFRAYVDGFEPNGCIEGKLSQMSKEVNARIEPFLRTTPRPLRLPDGPPCSQRSKFLLMDALALSIEDPSHEGEGIPLYDAIKCMKTFFGWKEPNIIKPHEKGINPNYLLTWKQVLAELQDIENEEKIPRTKNMKKTSQLKWALGENMAPEKVDFEDCKDVNDLKQYDSDEPEPRSLACWIQSEFNKACELTDSSWVELDEIGEDVAPIEHIASMRRNYFTAEVSHCRATEYIMKGVYINTALLNASCAAMDDFQLIPMISKRRTKEGRRKTNLYGFIIKGRSHLRNDTDVVNFVSMEFSLTDPRLEPHKWEKYCVLEIGDMLLRTAVGQVSRPMFLYVRTNGTSKIKMKWGMEMRRCLLQSLQQIESMIEAESSVKEKDLTKEFFENKSETWPIGESPKGVEEGSIGKVCRTLLAKSVFNSLYASPQLEGFSAESRKLLLIVQALRDNLEPGTFDLEGLYEAIEECLINDPWVLLNASWFNSFLTHALR

Source Source

Source organism organism	Influenza A virus (A/Zhejiang/DTID-ZJU01/2013(H7N9))
NCBI taxonomy ID ncbi_taxonomy_id	1318616
Host organism host_organism	Trichoplusia ni

Entity 2 Entity 2 polymer

Description description	RNA-directed RNA polymerase catalytic subunit
Molecular weight formula_weight	86496.2 kDa
EC 编号 ec_number	2.7.7.48
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,F

MDVNPTLLFLKVPVQNAISTTFPYTGDPPYSHGTGTGYTMDTVNRTHKYSEKGKWTTNTETGAPQLNPIDGPLPEDNEPSGYAQTDCVLEAMAFLEESHPGIFENSCLETMEIVQQTRVDKLTQGRQTYDWTLNRNQPAATALANTIEVFRSNGLTANESGRLIDFLKDVMDSMDKEEMEITTHFQRKRRVRDNMTKKMVTQRTIGKKKQRLNKRSYLIRALTLNTMTKDAERGKLKRRAIATPGMQIRGFVYFVEALARSICEKLEQSGLPVGGNEKKAKLANVVRKMMTNSQDTELSFTITGDNTKWNENQNPRMFLAMITYITRNQPEWFRNVLSIAPIMFSNKMARLGKGYMFESKSMKLRTQVPAEMLANIDLKYFNKSTREKIEKIRPLLIDGTASLSPGMMMGMFNMLSTVLGVSILNLGQKKYTKTTYWWDGLQSSDDFALIVNAPNHEGIQAGVDRFYRTCKLVGINMSKKKSYINRTGTFEFTSFFYRYGFVANFSMELPSFGVSGINESADMSVGVTVIKNNMINNDLGPATAQMALQLFIKDYRYTYRCHRGDTQIQTRRAFELKKLWEQTRSKAGLLVSDGGPNLYNIRNLHIPEVCLKWELMDEDYQGRLCNPMNPFVSHKEIDSVNNAVVMPAHGPAKSMEYDAVATTHSWIPKRNRSILNTSQRGILEDEQMYQKCCNLFEKFFPSSSYRRPVGISSMVEAMVSRARIDARIDFESGRIKKEEFAEIMKICSTIEELRRQK

Source Source

Source organism organism	Influenza A virus (A/Zhejiang/DTID-ZJU01/2013(H7N9))
NCBI taxonomy ID ncbi_taxonomy_id	1318616
Host organism host_organism	Trichoplusia ni

Entity 3 Entity 3 polymer

Description description	Polymerase basic protein 2
Molecular weight formula_weight	88937.4 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,G

MERIKELRDLMSQSRTREILTKTTVDHMAIIKKYTSGRQEKNPALRMKWMMAMKYPITADKRIMEMIPERNEQGQTLWSKTNDAGSDRVMVSPLAVTWWNRNGPTTSTVHYPKVYKTYFEKVERLKHGTFGPVHFRNQVKIRRRVDINPGHADLSAKEAQDVIMEVVFPNEVGARILTSESQLTITKEKKKELQDCKIAPLMVAYMLERELVRKTRFLPVAGGTSSVYIEVLHLTQGTCWEQMYTPGGEVRNDDVDQSLIIAARNIVRRATVSADPLASLLEMCHSTQIGGVRMVDILRQNPTEEQAVDICKAAMGLRISSSFSFGGFTFKRTSGSSVKREEEVLTGNLQTLKIRVHEGYEEFTMVGRRATAILRKATRRLIQLIVSGKDEQSIAEAIIVAMVFSQEDCMIKAVRGDLNFVNRANQRLNPMHQLLRHFQKDAKVLFQNWGIEPIDNVMGMIGILPDMTPSTEMSLRGVRVSKMGVDEYSSTERVVVSIDRFLRVRDQRGNVLLSPEEVSETQGTEKLTITYSSSMMWEINGPESVLVNTYQWIIRNWENVKIQWSQDPTMLYNKMEFEPFQSLVPKAARGQYSGFVRVLFQQMRDVLGTFDTVQIIKLLPFAAAPPEQSRMQFSSLTVNVRGSGMRIVVRGNSPVFNYNKATKRLTVLGKDAGALMEDPDEGTAGVESAVLRGFLILGKENKRYGPALSINELSNLAKGEKANVLIGQGDVVLVMKRKRDSSILTDSQTATKRIRMAINGWSHPQFEKGGGSGGGSGGSAWSHPQFEK

Source Source

Source organism organism	Influenza A virus (A/Zhejiang/DTID-ZJU01/2013(H7N9))
NCBI taxonomy ID ncbi_taxonomy_id	1318616
Host organism host_organism	Trichoplusia ni

Entity 4 Entity 4 polymer

Description description	51-mer vRNA loop (v51_mut_S)
Molecular weight formula_weight	16093.4 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R,V,S,U

AGUAGAAACAAGGGUGUAUUUUCCCCUCUUUUUGUUUCCCCUGCUUUUGCU

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.30 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	278761

Influenza A/H7N9 polymerase symmetric dimer bound to the promoter (PA K289A/C489R)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Polymerase acidic protein

State in the Current Structure

Other States of the Same Protein in the Database

RNA-directed RNA polymerase catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

Polymerase basic protein 2

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8poh__assembly_1__model_1

8poh__assembly_1__model_1 | I(q)

8poh__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)

Influenza A/H7N9 polymerase symmetric dimer bound to the promoter (PA K289A/C489R)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Polymerase acidic protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

RNA-directed RNA polymerase catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Polymerase basic protein 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8poh__assembly_1__model_1

8poh__assembly_1__model_1 | I(q)

8poh__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)