8s09

H. sapiens MCM2-7 double hexamer bound to double stranded DNA

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA replication licensing factor MCM2

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 12 DNA 2	DNA (45-mer) × 1 DNA (45-mer) × 1 DNA replication licensing factor MCM3 × 2 （P25205） DNA replication licensing factor MCM4 × 2 （P33991） DNA replication licensing factor MCM5 × 2 （P33992） DNA replication licensing factor MCM6 × 2 （Q14566） DNA replication licensing factor MCM7 × 2 （P33993） ADENOSINE-5'-TRIPHOSPHATE × 2 MAGNESIUM ION × 8 ZINC ION × 10 ADENOSINE-5'-DIPHOSPHATE × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MCM2_HUMAN
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain 2； PDBConstruct 1–904； UniProt 1–904 Author chain A； PDBConstruct 1–904； UniProt 1–904

DNA replication licensing factor MCM3

Homo sapiens

UniProt P25205

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 12 DNA 2	DNA (45-mer) × 1 DNA (45-mer) × 1 DNA replication licensing factor MCM2 × 2 （P49736） DNA replication licensing factor MCM4 × 2 （P33991） DNA replication licensing factor MCM5 × 2 （P33992） DNA replication licensing factor MCM6 × 2 （Q14566） DNA replication licensing factor MCM7 × 2 （P33993） ADENOSINE-5'-TRIPHOSPHATE × 2 MAGNESIUM ION × 8 ZINC ION × 10 ADENOSINE-5'-DIPHOSPHATE × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MCM3_HUMAN
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain 3； PDBConstruct 3–810； UniProt 1–808 Author chain B； PDBConstruct 3–810； UniProt 1–808

DNA replication licensing factor MCM4

Homo sapiens

UniProt P33991

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 12 DNA 2	DNA (45-mer) × 1 DNA (45-mer) × 1 DNA replication licensing factor MCM2 × 2 （P49736） DNA replication licensing factor MCM3 × 2 （P25205） DNA replication licensing factor MCM5 × 2 （P33992） DNA replication licensing factor MCM6 × 2 （Q14566） DNA replication licensing factor MCM7 × 2 （P33993） ADENOSINE-5'-TRIPHOSPHATE × 2 MAGNESIUM ION × 8 ZINC ION × 10 ADENOSINE-5'-DIPHOSPHATE × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MCM4_HUMAN
Isoform	—
PDB entities	5
Chains and sequence ranges	Author chain 4； PDBConstruct 1–863； UniProt 1–863 Author chain C； PDBConstruct 1–863； UniProt 1–863

DNA replication licensing factor MCM5

Homo sapiens

UniProt P33992

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 12 DNA 2	DNA (45-mer) × 1 DNA (45-mer) × 1 DNA replication licensing factor MCM2 × 2 （P49736） DNA replication licensing factor MCM3 × 2 （P25205） DNA replication licensing factor MCM4 × 2 （P33991） DNA replication licensing factor MCM6 × 2 （Q14566） DNA replication licensing factor MCM7 × 2 （P33993） ADENOSINE-5'-TRIPHOSPHATE × 2 MAGNESIUM ION × 8 ZINC ION × 10 ADENOSINE-5'-DIPHOSPHATE × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MCM5_HUMAN
Isoform	—
PDB entities	6
Chains and sequence ranges	Author chain 5； PDBConstruct 1–734； UniProt 1–734 Author chain D； PDBConstruct 1–734； UniProt 1–734

DNA replication licensing factor MCM6

Homo sapiens

UniProt Q14566

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 12 DNA 2	DNA (45-mer) × 1 DNA (45-mer) × 1 DNA replication licensing factor MCM2 × 2 （P49736） DNA replication licensing factor MCM3 × 2 （P25205） DNA replication licensing factor MCM4 × 2 （P33991） DNA replication licensing factor MCM5 × 2 （P33992） DNA replication licensing factor MCM7 × 2 （P33993） ADENOSINE-5'-TRIPHOSPHATE × 2 MAGNESIUM ION × 8 ZINC ION × 10 ADENOSINE-5'-DIPHOSPHATE × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MCM6_HUMAN
Isoform	—
PDB entities	7
Chains and sequence ranges	Author chain 6； PDBConstruct 1–821； UniProt 1–821 Author chain E； PDBConstruct 1–821； UniProt 1–821

DNA replication licensing factor MCM7

Homo sapiens

UniProt P33993

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 12 DNA 2	DNA (45-mer) × 1 DNA (45-mer) × 1 DNA replication licensing factor MCM2 × 2 （P49736） DNA replication licensing factor MCM3 × 2 （P25205） DNA replication licensing factor MCM4 × 2 （P33991） DNA replication licensing factor MCM5 × 2 （P33992） DNA replication licensing factor MCM6 × 2 （Q14566） ADENOSINE-5'-TRIPHOSPHATE × 2 MAGNESIUM ION × 8 ZINC ION × 10 ADENOSINE-5'-DIPHOSPHATE × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MCM7_HUMAN
Isoform	—
PDB entities	8
Chains and sequence ranges	Author chain 7； PDBConstruct 1–719； UniProt 1–719 Author chain F； PDBConstruct 1–719； UniProt 1–719

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8s09
Deposition date deposition_date	2024-02-13
Structure title title	H. sapiens MCM2-7 double hexamer bound to double stranded DNA
Keywords keywords	AAA+ ATPase, DNA helicase, REPLICATION; REPLICATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8s09__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8s09__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8s09__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	72.46 Å
Rg (electron density)	73.01 Å
Total Rg	72.89 Å
Atom count	64107
Residues	7892
Excluded volume	1135000 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8s09__assembly_1__model_1`	14-meric （14）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (12)

Entity 1 Entity 1 polymer

Description description	DNA (45-mer)
Molecular weight formula_weight	13853.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	X
Atom count atom_count	64107

GCATGCATGCGCATGCATGCATTATGCATGCATGCGCATGCATGC

Entity 2 Entity 2 polymer

Description description	DNA (45-mer)
Molecular weight formula_weight	13862.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Y

GCATGCATGCGCATGCATGCATAATGCATGCATGCGCATGCATGC

Entity 3 Entity 3 polymer

Description description	DNA replication licensing factor MCM2
Molecular weight formula_weight	102034.1 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	2,A

MAESSESFTMASSPAQRRRGNDPLTSSPGRSSRRTDALTSSPGRDLPPFEDESEGLLGTEGPLEEEEDGEELIGDGMERDYRAIPELDAYEAEGLALDDEDVEELTASQREAAERAMRQRDREAGRGLGRMRRGLLYDSDEEDEERPARKRRQVERATEDGEEDEEMIESIENLEDLKGHSVREWVSMAGPRLEIHHRFKNFLRTHVDSHGHNVFKERISDMCKENRESLVVNYEDLAAREHVLAYFLPEAPAELLQIFDEAALEVVLAMYPKYDRITNHIHVRISHLPLVEELRSLRQLHLNQLIRTSGVVTSCTGVLPQLSMVKYNCNKCNFVLGPFCQSQNQEVKPGSCPECQSAGPFEVNMEETIYQNYQRIRIQESPGKVAAGRLPRSKDAILLADLVDSCKPGDEIELTGIYHNNYDGSLNTANGFPVFATVILANHVAKKDNKVAVGELTDEDVKMITSLSKDQQIGEKIFASIAPSIYGHEDIKRGLALALFGGEPKNPGGKHKVRGDINVLLCGDPGTAKSQFLKYIEKVSSRAIFTTGQGASAVGLTAYVQRHPVSREWTLEAGALVLADRGVCLIDEFDKMNDQDRTSIHEAMEQQSISISKAGIVTSLQARCTVIAAANPIGGRYDPSLTFSENVDLTEPIISRFDILCVVRDTVDPVQDEMLARFVVGSHVRHHPSNKEEEGLANGSAAEPAMPNTYGVEPLPQEVLKKYIIYAKERVHPKLNQMDQDKVAKMYSDLRKESMATGSIPITVRHIESMIRMAEAHARIHLRDYVIEDDVNMAIRVMLESFIDTQKFSVMRSMRKTFARYLSFRRDNNELLLFILKQLVAEQVTYQRNRFGAQQDTIEVPEKDLVDKARQINIHNLSAFYDSELFRMNKFSHDLKRKMILQQF

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 4 Entity 4 polymer

Description description	DNA replication licensing factor MCM3
Molecular weight formula_weight	91297.0 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	3,B

GEMAGTVVLDDVELREAQRDYLDFLDDEEDQGIYQSKVRELISDNQYRLIVNVNDLRRKNEKRANRLLNNAFEELVAFQRALKDFVASIDATYAKQYEEFYVGLEGSFGSKHVSPRTLTSCFLSCVVCVEGIVTKCSLVRPKVVRSVHYCPATKKTIERRYSDLTTLVAFPSSSVYPTKDEENNPLETEYGLSVYKDHQTITIQEMPEKAPAGQLPRSVDVILDDDLVDKAKPGDRVQVVGTYRCLPGKKGGYTSGTFRTVLIACNVKQMSKDAQPSFSAEDIAKIKKFSKTRSKDIFDQLAKSLAPSIHGHDYVKKAILCLLLGGVERDLENGSHIRGDINILLIGDPSVAKSQLLRYVLCTAPRAIPTTGRGSSGVGLTAAVTTDQETGERRLEAGAMVLADRGVVCIDEFDKMSDMDRTAIHEVMEQGRVTIAKAGIHARLNARCSVLAAANPVYGRYDQYKTPMENIGLQDSLLSRFDLLFIMLDQMDPEQDREISDHVLRMHRYRAPGEQDGDAMPLGSAVDILATDDPNFSQEDQQDTQIYEKHDNLLHGTKKKKEKMVSAAFMKKYIHVAKIIKPVLTQESATYIAEEYSRLRSQDSMSSDTARTSPVTARTLETLIRLATAHAKARMSKTVDLQDAEEAVELVQYAYFKKVLEKEKKRKKRSEDESETEDEEEKSQEDQEQKRKRRKTRQPDAKDGDSYDPYDFSDTEEEMPQVHTPKTADSQETKESQKVELSESRLKAFKVALLDVFREAHAQSIGMNRLTESINRDSEEPFSSVEIQAALSKMQDDNQVMVSEGIIFLI

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 5 Entity 5 polymer

Description description	DNA replication licensing factor MCM4
Molecular weight formula_weight	96702.9 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	4,C

MSSPASTPSRRGSRRGRATPAQTPRSEDARSSPSQRRRGEDSTSTGELQPMPTSPGVDLQSPAAQDVLFSSPPQMHSSAIPLDFDVSSPLTYGTPSSRVEGTPRSGVRGTPVRQRPDLGSAQKGLQVDLQSDGAAAEDIVASEQSLGQKLVIWGTDVNVAACKENFQRFLQRFIDPLAKEEENVGIDITEPLYMQRLGEINVIGEPFLNVNCEHIKSFDKNLYRQLISYPQEVIPTFDMAVNEIFFDRYPDSILEHQIQVRPFNALKTKNMRNLNPEDIDQLITISGMVIRTSQLIPEMQEAFFQCQVCAHTTRVEMDRGRIAEPSVCGRCHTTHSMALIHNRSLFSDKQMIKLQESPEDMPAGQTPHTVILFAHNDLVDKVQPGDRVNVTGIYRAVPIRVNPRVSNVKSVYKTHIDVIHYRKTDAKRLHGLDEEAEQKLFSEKRVELLKELSRKPDIYERLASALAPSIYEHEDIKKGILLQLFGGTRKDFSHTGRGKFRAEINILLCGDPGTSKSQLLQYVYNLVPRGQYTSGKGSSAVGLTAYVMKDPETRQLVLQTGALVLSDNGICCIDEFDKMNESTRSVLHEVMEQQTLSIAKAGIICQLNARTSVLAAANPIESQWNPKKTTIENIQLPHTLLSRFDLIFLMLDPQDEAYDRRLAHHLVALYYQSEEQAEEELLDMAVLKDYIAYAHSTIMPRLSEEASQALIEAYVDMRKIGSSRGMVSAYPRQLESLIRLAEAHAKVRLSNKVEAIDVEEAKRLHREALKQSATDPRTGIVDISILTTGMSATSRKRKEELAEALKKLILSKGKTPALKYQQLFEDIRGQSDIAITKDMFEEALRALADDDFLTVTGKTVRLL

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 6 Entity 6 polymer

Description description	DNA replication licensing factor MCM5
Molecular weight formula_weight	82406.6 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	5,D

MSGFDDPGIFYSDSFGGDAQADEGQARKSQLQRRFKEFLRQYRVGTDRTGFTFKYRDELKRHYNLGEYWIEVEMEDLASFDEDLADYLYKQPAEHLQLLEEAAKEVADEVTRPRPSGEEVLQDIQVMLKSDASPSSIRSLKSDMMSHLVKIPGIIIAASAVRAKATRISIQCRSCRNTLTNIAMRPGLEGYALPRKCNTDQAGRPKCPLDPYFIMPDKCKCVDFQTLKLQELPDAVPHGEMPRHMQLYCDRYLCDKVVPGNRVTIMGIYSIKKFGLTTSRGRDRVGVGIRSSYIRVLGIQVDTDGSGRSFAGAVSPQEEEEFRRLAALPNVYEVISKSIAPSIFGGTDMKKAIACLLFGGSRKRLPDGLTRRGDINLLMLGDPGTAKSQLLKFVEKCSPIGVYTSGKGSSAAGLTASVMRDPSSRNFIMEGGAMVLADGGVVCIDEFDKMREDDRVAIHEAMEQQTISIAKAGITTTLNSRCSVLAAANSVFGRWDETKGEDNIDFMPTILSRFDMIFIVKDEHNEERDVMLAKHVITLHVSALTQTQAVEGEIDLAKLKKFIAYCRVKCGPRLSAEAAEKLKNRYIIMRSGARQHERDSDRRSSIPITVRQLEAIVRIAEALSKMKLQPFATEADVEEALRLFQVSTLDAALSGTLSGVEGFTSQEDQEMLSRIEKQLKRRFAIGSQVSEHSIIKDFTKQKYPEHAIHKVLQLMLRRGEIQHRMQRKVLYRLK

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 7 Entity 7 polymer

Description description	DNA replication licensing factor MCM6
Molecular weight formula_weight	93010.3 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	6,E

MDLAAAAEPGAGSQHLEVRDEVAEKCQKLFLDFLEEFQSSDGEIKYLQLAEELIRPERNTLVVSFVDLEQFNQQLSTTIQEEFYRVYPYLCRALKTFVKDRKEIPLAKDFYVAFQDLPTRHKIRELTSSRIGLLTRISGQVVRTHPVHPELVSGTFLCLDCQTVIRDVEQQFKYTQPNICRNPVCANRRRFLLDTNKSRFVDFQKVRIQETQAELPRGSIPRSLEVILRAEAVESAQAGDKCDFTGTLIVVPDVSKLSTPGARAETNSRVSGVDGYETEGIRGLRALGVRDLSYRLVFLACCVAPTNPRFGGKELRDEEQTAESIKNQMTVKEWEKVFEMSQDKNLYHNLCTSLFPTIHGNDEVKRGVLLMLFGGVPKTTGEGTSLRGDINVCIVGDPSTAKSQFLKHVEEFSPRAVYTSGKASSAAGLTAAVVRDEESHEFVIEAGALMLADNGVCCIDEFDKMDVRDQVAIHEAMEQQTISITKAGVKATLNARTSILAAANPISGHYDRSKSLKQNINLSAPIMSRFDLFFILVDECNEVTDYAIARRIVDLHSRIEESIDRVYSLDDIRRYLLFARQFKPKISKESEDFIVEQYKHLRQRDGSGVTKSSWRITVRQLESMIRLSEAMARMHCCDEVQPKHVKEAFRLLNKSIIRVETPDVNLDQEEEIQMEVDEGAGGINGHADSPAPVNGINGYNEDINQESAPKASLRLGFSEYCRISNLIVLHLRKVEEEEDESALKRSELVNWYLKEIESEIDSEEELINKKRIIEKVIHRLTHYDHVLIELTQAGLKGSTEGSESYEEDPYLVVNPNYLLED

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 8 Entity 8 polymer

Description description	DNA replication licensing factor MCM7
Molecular weight formula_weight	81411.9 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	7,F

MALKDYALEKEKVKKFLQEFYQDDELGKKQFKYGNQLVRLAHREQVALYVDLDDVAEDDPELVDSICENARRYAKLFADAVQELLPQYKEREVVNKDVLDVYIEHRLMMEQRSRDPGMVRSPQNQYPAELMRRFELYFQGPSSNKPRVIREVRADSVGKLVTVRGIVTRVSEVKPKMVVATYTCDQCGAETYQPIQSPTFMPLIMCPSQECQTNRSGGRLYLQTRGSRFIKFQEMKMQEHSDQVPVGNIPRSITVLVEGENTRIAQPGDHVSVTGIFLPILRTGFRQVVQGLLSETYLEAHRIVKMNKSEDDESGAGELTREELRQIAEEDFYEKLAASIAPEIYGHEDVKKALLLLLVGGVDQSPRGMKIRGNINICLMGDPGVAKSQLLSYIDRLAPRSQYTTGRGSSGVGLTAAVLRDSVSGELTLEGGALVLADQGVCCIDEFDKMAEADRTAIHEVMEQQTISIAKAGILTTLNARCSILAAANPAYGRYNPRRSLEQNIQLPAALLSRFDLLWLIQDRPDRDNDLRLAQHITYVHQHSRQPPSQFEPLDMKLMRRYIAMCREKQPMVPESLADYITAAYVEMRREAWASKDATYTSARTLLAILRLSTALARLRMVDVVEKEDVNEAIRLMEMSKDSLLGDKGQTARTQRPADVIFATVRELVSGGRSVRFSEAEQRCVSRGFTPAQFQAALDEYEELNVWQVNASRTRITFV

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 9 Entity 9 non-polymer

Description description	ADENOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	507.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 10 Entity 10 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	8

Entity 11 Entity 11 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	10

Entity 12 Entity 12 non-polymer

Description description	ADENOSINE-5'-DIPHOSPHATE
Molecular weight formula_weight	427.2 kDa
Source method src_method	syn
Copy count entity_count	8

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	3.10 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	15874

H. sapiens MCM2-7 double hexamer bound to double stranded DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA replication licensing factor MCM2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA replication licensing factor MCM3

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA replication licensing factor MCM4

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA replication licensing factor MCM5

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA replication licensing factor MCM6

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA replication licensing factor MCM7

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8s09__assembly_1__model_1

8s09__assembly_1__model_1 | I(q)

8s09__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (12)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

Entity 6 Entity 6 polymer

Polymer Polymer

Source Source

Entity 7 Entity 7 polymer

Polymer Polymer

Source Source

Entity 8 Entity 8 polymer