SAXSdb — 8zd0

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cas9

Staphylococcus aureus

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Other combination Monomer Protein × 1 DNA 2 RNA 1 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 1–1053	Not recorded	sgRNA × 1 Target DNA strand × 1 Non-target DNA strand × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.6 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 2.76 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 8ZD0	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
5AXW Crystal structure of Staphylococcus aureus Cas9 in complex with sgRNA and target DNA (TTGGGT PAM) Deposited 2015-08-01	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1053（1053 aa）	Mutation：N580A/C946A	NA SODIUM ION × 4 PO4 PHOSPHATE ION × 1 EDO 1,2-ETHANEDIOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG4000, NaCl, Na2HPO4, NaN3	Resolution 2.70 Å R-free 0.230
5CZZ Crystal structure of Staphylococcus aureus Cas9 in complex with sgRNA and target DNA (TTGAAT PAM) Deposited 2015-08-01	Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1053（1053 aa）	Mutation：N580A/C946A	NA SODIUM ION × 5 PO4 PHOSPHATE ION × 1 EDO 1,2-ETHANEDIOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG4000, NaCl, Na2HPO4, NaN3	Resolution 2.60 Å R-free 0.241
7EL1 Structure of a protein from bacteria Deposited 2021-04-07	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 2 PDB declaration: pentameric	Chain A 1–1053（1053 aa）	Mutation：N580A, C946A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；1.0M sodium citrate dihydrate, 0.3M imidazol-Hcl (pH 10.0), 0.02M sodium malonate (pH 7.0)	Resolution 2.22 Å R-free 0.242
7ENH Crystal structure of cas and anti-cas protein complex Deposited 2021-04-17	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 481–646（166 aa） Fragment：HNH domain	Not recorded	NI NICKEL (II) ION × 11	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289.15 K；PEG 3350, sodium iodide	Resolution 2.10 Å R-free 0.208
7ENI Crystal structure of cas and anti-cas protein complex Deposited 2021-04-17	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1053（1053 aa）	Not recorded	PO4 PHOSPHATE ION × 9	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289.15 K；Tris, Ammonium phosphate dibasic	Resolution 2.63 Å R-free 0.237
7ENR Crystal structure of cas and anti-cas protein complex Deposited 2021-04-19	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1053（1053 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289.15 K；PEG 3350, EG, Bicine	Resolution 4.21 Å R-free 0.307
7VW3 Cryo-EM structure of SaCas9-sgRNA-DNA ternary complex Deposited 2021-11-09	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 2–1053（1052 aa）	Mutation：D10A N580A	MG MAGNESIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20mM Tris-Cl (pH 7.5), 100mM KCl, 5mM MgCl2, 1mM DTT cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.80 Å
8JFT Cryo-EM structure of SaCas9-AcrIIA15 CTD-sgRNA complex Deposited 2023-05-18	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 2 PDB declaration: trimeric	Chain A 1–1053（1053 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.31 Å
8JG9 Cryo-EM structure of the SaCas9-sgRNA-AcrIIA15-promoter DNA dimer Deposited 2023-05-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 4 PDB declaration: octameric	Chain A 1–1053（1053 aa） Chain D 1–1053（1053 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.82 Å
8Y0D Crystal structure of SauCas9 in complex with sgRNA and 20nt ssDNA target Deposited 2024-01-22	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–1053（1053 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；0.2 M Sodium chloride, 0.1 M Sodium HEPES, pH 7.0, 11% PEG 8000	Resolution 3.92 Å R-free 0.318
8ZCY Cryo-EM structure of eSaCas9_NNG-guide RNA-target DNA complex in an interrogation state Deposited 2024-04-30	Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1053（1053 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.17 Å
8ZCZ Cryo-EM structure of eSaCas9_NNG-guide RNA-target DNA complex in an intermediate state Deposited 2024-04-30	Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1053（1053 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8ZDA Cryo-EM structure of eSaCas9_NNG-guide RNA-target DNA complex in a catalytically active state Deposited 2024-05-01	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: pentameric	Chain A 1–1053（1053 aa）	Not recorded	MG MAGNESIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.14 Å
9MB6 Cryo-EM structure of wild-type SaCas9-guide RNA-mismatched target DNA complex Deposited 2025-03-15	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Insufficient information Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1053（1053 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.01 Å
9MB7 Cryo-EM structure of eSaCas9-NNG-guide RNA-mismatched target DNA complex Deposited 2025-03-15	Different oligomeric state Different structure-quality metrics	Assembly 1 Insufficient information Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–1053（1053 aa）	Not recorded	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.88 Å

15 other PDB entries and 15 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	CAS9_STAAU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 4–1056； UniProt 1–1053

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8zd0
Deposition date deposition_date	2024-04-30
Structure title title	Cryo-EM structure of eSaCas9_NNG-guide RNA-target DNA complex in a translocation state
Keywords keywords	CRISPR-CAS9, GENOME ENGINEERING, HYDROLASE-RNA-DNA COMPLEX, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	36.88 Å
Radius of gyration Rg (electron density) rg_electron	36.79 Å
Forward intensity I(0) i0	487189000.00
Molecular weight molecular_weight	147240.0 kDa
Excluded volume excluded_volume	170690 Å³
Envelope volume envelope_volume	247300 Å³
Hydration-shell volume shell_volume	54997 Å³
Envelope diameter envelope_diameter	128.5 Å
Shell Rg shell_rg	43.81 Å
Envelope Rg envelope_rg	36.40 Å
Shape Rg shape_rg	36.82 Å
Total Rg total_rg	37.11 Å
Total atoms total_atoms	10167
Residues n_residues	991
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	119.0 Å
Rg (real space) rg_real	36.79 Å
Rg uncertainty (real space) rg_real_error	0.90 Å
I(0) (real space) i0_real	4.8720e+08
I(0) uncertainty (real space) i0_real_error	7.4970e+06
Rg (reciprocal space) rg_reciprocal	36.85 Å
I(0) (reciprocal space) i0_reciprocal	487200000.0000
Solution quality estimate total_estimate	0.8889
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	44.3 Å
Skewness Skewness skewness	0.265
Kurtosis Kurtosis kurtosis	-0.363
Angular range angular_range	— – 0.2150 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	46950000.0000
Real-space data points n_real_points	44
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.913; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 1.000; Smooth: 0.813

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	CRISPR-associated endonuclease Cas9
Molecular weight formula_weight	124305.9 kDa
EC 编号 ec_number	3.1.-.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	10185

GSHMKRNYILGLDIGITSVGYGIIDYETRDVIDAGVRLFKEANVENNEGRRSKRGARRLKRRRRHRIQRVKKLLFDYNLLTDHSELSGINPYEARVKGLSQKLSEEEFSAALLHLAKRRGVHNVNEVEEDTGNELSTKEQISRNSKALEEKYVAELQLERLKKDGEVRGSINRFKTSDYVKEAKQLLKVQKAYHQLDQSFIDTYIDLLETRRTYYEGPGEGSPFGWKDIKEWYEMLMGHCTYFPEELRSVKYAYNADLYNALNDLNNLVITRDENEKLEYYEKFQIIENVFKQKKKPTLKQIAKEILVNEEDIKGYRVTSTGKPEFTNLKVYHDIKDITARKEIIENAELLDQIAKILTIYQSSEDIQEELTNLNSELTQEEIEQISNLKGYTGTHNLSLKAINLILDELWHTNDAQIAIFNALKLVPKKVDLSQQKEIPTTLVDDFILSPVVKRSFIQSIKVINAIIKKYGLPNDIIIELAREKNSKDAQKMINEMQKRNRQTNERIEEIIRTTGKENAKYLIEKIKLHDMQEGKCLYSLEAIPLEDLLNNPFNYEVDHIIPRSVSFDNSFNNKVLVKQEENSKKGNRTPFQYLSSSDSKISYETFKKHILNLAKGKGRISKTKKEYLLEERDINRFSVQKDFINRNLVDTRYATRGLMNLLRSYFRVNNLDVKVKSINGGFTSFLRRKWKFKKERNKGYKHHAEDALIIANADFIFKEWKKLDKAKKVMENQMFEEKQAESMPEIETEQEYKEIFITPHQIKHIKDFKDYKYSHRVDKKPNRKLINDTLYSTRKDDKGNTRIVNNLNGLYDKDNDKLKKLINKSPEKLLMYHHDPQTYQKLKLIMEQYGDEKNPLYKYYEETGNYLTKYSKKDNGPVIKKIKYYGNKLNAHLDITDDYPNSRNKVVKLSLKPYRFDVYLDNGVYKFVKVNNLDVIKKENYYEVNSKCYEEAKKLKKISNQAEFIASFYRNDLIKINGELYRVIGVASDLLNAIEVNMIDITYREYLENMNDKRPPRIFKTISSKTQSIKKYSTDILGNLYEVKSKKHPQIIKKG

来源 Source

来源生物 organism	Staphylococcus aureus
NCBI Class编号 ncbi_taxonomy_id	1280
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	sgRNA
Molecular weight formula_weight	31892.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GGGAAAUUAGGUGCGCUUGGCGUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUA

来源 Source

来源生物 organism	Staphylococcus aureus
NCBI Class编号 ncbi_taxonomy_id	1280
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	Target DNA strand
Molecular weight formula_weight	13315.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

ATTTGAATAGGCAAGCCAAGCGCACCTAATTTCCCGTATTTAG

来源 Source

来源生物 organism	Staphylococcus aureus
NCBI Class编号 ncbi_taxonomy_id	1280
宿主生物 host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	Non-target DNA strand
Molecular weight formula_weight	13386.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CTAAATACGGGAAATTAGGTGCGCTTGGCTTGCCTATTCAAAT

来源 Source

来源生物 organism	Staphylococcus aureus
NCBI Class编号 ncbi_taxonomy_id	1280
宿主生物 host_organism	Escherichia coli

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.76 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	143305

fit	/app/data/saxs_computation/zd/8zd0/8zd0.fit
pddf	/app/data/pr_computation/zd/8zd0/8zd0.pr.out
profile	/app/data/saxs_computation/zd/8zd0/8zd0.dat

Cryo-EM structure of eSaCas9_NNG-guide RNA-target DNA complex in a translocation state

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated endonuclease Cas9

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 polymer

Polymer Polymer

来源 Source

Entity 4 Entity 4 polymer

Polymer Polymer

来源 Source

Entity 5 Entity 5 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)