SAXSdb — 9mb7

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ubiquitin-like protein SMT3,CRISPR-associated endonuclease Cas9

Staphylococcus aureus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 2 RNA 1	target DNA strand × 1 non-target DNA strand × 1 sgRNA × 1 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	CAS9_STAAU
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 118–1170； UniProt 1–1053

Ubiquitin-like protein SMT3,CRISPR-associated endonuclease Cas9

Staphylococcus aureus

UniProt Q12306

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 2 RNA 1	target DNA strand × 1 non-target DNA strand × 1 sgRNA × 1 MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SMT3_YEAST
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 13–108； UniProt 3–98

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9mb7
Deposition date deposition_date	2025-03-15
Structure title title	Cryo-EM structure of eSaCas9-NNG-guide RNA-mismatched target DNA complex
Keywords keywords	CRISPR-CAS9, GENOME ENGINEERING, HYDROLASE-RNA-DNA COMPLEX, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9mb7__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9mb7__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9mb7__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	36.60 Å
Rg (electron density)	36.10 Å
Total Rg	36.52 Å
Atom count	11614
Residues	1140
Excluded volume	195580 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9mb7__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	target DNA strand
Molecular weight formula_weight	13355.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C
Atom count atom_count	11622

ATTTGAATAGGCAAGCCAAGCGCACCTAATTTCCGGTATTTAG

Source Source

Source organism organism	Staphylococcus aureus
NCBI taxonomy ID ncbi_taxonomy_id	1280
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	non-target DNA strand
Molecular weight formula_weight	13386.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CTAAATACGGGAAATTAGGTGCGCTTGGCTTGCCTATTCAAAT

Source Source

Source organism organism	Staphylococcus aureus
NCBI taxonomy ID ncbi_taxonomy_id	1280
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	Ubiquitin-like protein SMT3,CRISPR-associated endonuclease Cas9
Molecular weight formula_weight	137515.5 kDa
EC 编号 ec_number	3.1.-.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MGHHHHHHGSLQDSEVNQEAKPEVKPEVKPETHINLKVSDGSSEIFFKIKKTTPLRRLMEAFAKRQGKEMDSLRFLYDGIRIQADQAPEDLDMEDNDIIEAHREQIGGENLYFQGSHMKRNYILGLDIGITSVGYGIIDYETRDVIDAGVRLFKEANVENNEGRRSKRGARRLKRRRRHRIQRVKKLLFDYNLLTDHSELSGINPYEARVKGLSQKLSEEEFSAALLHLAKRRGVHNVNEVEEDTGNELSTKEQISRNSKALEEKYVAELQLERLKKDGEVRGSINRFKTSDYVKEAKQLLKVQKAYHQLDQSFIDTYIDLLETRRTYYEGPGEGSPFGWKDIKEWYEMLMGHCTYFPEELRSVKYAYNADLYNALNDLNNLVITRDENEKLEYYEKFQIIENVFKQKKKPTLKQIAKEILVNEEDIKGYRVTSTGKPEFTNLKVYHDIKDITARKEIIENAELLDQIAKILTIYQSSEDIQEELTNLNSELTQEEIEQISNLKGYTGTHNLSLKAINLILDELWHTNDAQIAIFNALKLVPKKVDLSQQKEIPTTLVDDFILSPVVKRSFIQSIKVINAIIKKYGLPNDIIIELAREKNSKDAQKMINEMQKRNRQTNERIEEIIRTTGKENAKYLIEKIKLHDMQEGKCLYSLEAIPLEDLLNNPFNYEVDHIIPRSVSFDNSFNNKVLVKQEENSKKGNRTPFQYLSSSDSKISYETFKKHILNLAKGKGRISKTKKEYLLEERDINRFSVQKDFINRNLVDTRYATRGLMNLLRSYFRVNNLDVKVKSINGGFTSFLRRKWKFKKERNKGYKHHAEDALIIANADFIFKEWKKLDKAKKVMENQMFEEKQAESMPEIETEQEYKEIFITPHQIKHIKDFKDYKYSHRVDKKPNRKLINDTLYSTRKDDKGNTRIVNNLNGLYDKDNDKLKKLINKSPEKLLMYHHDPQTYQKLKLIMEQYGDEKNPLYKYYEETGNYLTKYSKKDNGPVIKKIKYYGNKLNAHLDITDDYPNSRNKVVKLSLKPYRFDVYLDNGVYKFVKVNNLDVIKKENYYEVNSKCYEEAKKLKKISNQAEFIASFYRNDLIKINGELYRVIGVASDLLNAIEVNMIDITYREYLENMNDKRPPRIFKTISSKTQSIKKYSTDILGNLYEVKSKKHPQIIKKG

Source Source

Source organism organism	Staphylococcus aureus
NCBI taxonomy ID ncbi_taxonomy_id	1280
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	sgRNA
Molecular weight formula_weight	31892.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GGGAAAUUAGGUGCGCUUGGCGUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUA

Source Source

Source organism organism	Staphylococcus aureus
NCBI taxonomy ID ncbi_taxonomy_id	1280
Host organism host_organism	Escherichia coli

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.88 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	123595

Cryo-EM structure of eSaCas9-NNG-guide RNA-mismatched target DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ubiquitin-like protein SMT3,CRISPR-associated endonuclease Cas9

State in the Current Structure

Other States of the Same Protein in the Database

Ubiquitin-like protein SMT3,CRISPR-associated endonuclease Cas9

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9mb7__assembly_1__model_1

9mb7__assembly_1__model_1 | I(q)

9mb7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

7. Citations (1)

Cryo-EM structure of eSaCas9-NNG-guide RNA-mismatched target DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ubiquitin-like protein SMT3,CRISPR-associated endonuclease Cas9

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Ubiquitin-like protein SMT3,CRISPR-associated endonuclease Cas9

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9mb7__assembly_1__model_1

9mb7__assembly_1__model_1 | I(q)

9mb7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

7. Citations (1)