9cey

Spizellomyces punctatus Fanzor (SpuFz) State 5

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Maltose/maltodextrin-binding periplasmic protein,Spizellomyces punctatus Fanzor 1

Spizellomyces punctatus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 2 RNA 1	DNA (26-MER) × 1 DNA (36-MER) × 1 RNA (76-MER) × 1 MAGNESIUM ION × 2 ZINC ION × 1 water × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	A0A0L0H5U9_SPIPD
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain P； PDBConstruct 396–1032； UniProt 2–638

Maltose/maltodextrin-binding periplasmic protein,Spizellomyces punctatus Fanzor 1

Spizellomyces punctatus

UniProt P0AEX9

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 2 RNA 1	DNA (26-MER) × 1 DNA (36-MER) × 1 RNA (76-MER) × 1 MAGNESIUM ION × 2 ZINC ION × 1 water × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MALE_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain P； PDBConstruct 19–384； UniProt 27–392

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9cey
Deposition date deposition_date	2024-06-27
Structure title title	Spizellomyces punctatus Fanzor (SpuFz) State 5
Keywords keywords	Fanzor, Eukaryotic, RNA-guided, nuclease, Gene editing, RNA BINDING PROTEIN-RNA-DNA complex; RNA BINDING PROTEIN/RNA/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9cey__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9cey__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9cey__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	32.56 Å
Rg (electron density)	31.54 Å
Total Rg	32.15 Å
Atom count	7528
Residues	728
Excluded volume	125170 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9cey__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	DNA (26-MER)
Molecular weight formula_weight	16652.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	N
Atom count atom_count	7529

ATTCGAGCTCGGTACCCGGGCATATCTATAGGTTATGAAATCAAATTACAAATA

Entity 2 Entity 2 polymer

Description description	Maltose/maltodextrin-binding periplasmic protein,Spizellomyces punctatus Fanzor 1
Molecular weight formula_weight	118029.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	P

MKSSHHHHHHHHHHGSSMKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELAKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTGSENLYFQSNAPPKKKQKLERLKKLDKPTLHTCNKTSFAKAFLPNETYRQRLLDYIAIIHQLADHASHALKFYILSTSTSSFPVVHEDTIEAILYLLNKGEAWHPRKEAKKAWRDCLLPYVQRYCQIVGFIHPNLRGEQQSINYLTVSMMTNLKVNVQEHFMQMLLRYINLRFDVKGQKQRLPPKSDARKAFFTRLRYLKSVFLFDVVPELEFLDDLTPLESEVLEEIWSLDLPFLPNDPLAYAIVADPMSFFPAYCKLSGLYEQYGFQRFSAIPLRRSLIQSHVRIDTIILYQHILCITRRDAETVEKDDLWMRVCNLCTKAFRSRCGMHFEGSITTDGASVSVYLKHPEADKYGKRGARKSANTVAAEVKALYVENNLPACRAAENVVVIDPNKRDILYCQDSNGTTFRYTANQRAVETGSRRFAKRREAMKEEAGVDLIESRIPSHKTMNLMDFTRYLLVRRADWDRRKEFYSHPAHTRWKWHSFINRQKSESDLISNMRNKYGENFTVVMGDWSDAGRTARFQTSSKTKGWRTLFKRNRIDCFLLDEYKTSSVCPRCSSSEFVEKKFKTRPHSRPWRRREGKIEKVHGLLGCTNPNCLQQAWTSGMRYWNRDMLSTCNMLLIVRSMLDGHGRPEVFSRSVPAVA

Source Source

Source organism organism	Spizellomyces punctatus
NCBI taxonomy ID ncbi_taxonomy_id	109760
Host organism host_organism	Saccharomyces cerevisiae

Entity 3 Entity 3 polymer

Description description	DNA (36-MER)
Molecular weight formula_weight	11247.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T

ATTTGANTTCATAACCTATAGATATGCCCGGGTACCG

Entity 4 Entity 4 polymer

Description description	RNA (76-MER)
Molecular weight formula_weight	30734.2 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	W

GUUUUCCGAGCCGGUUGUCGCGCGGUUCAAUCCCUGGUGCGGGUGCUAGUGCCAAUACCCACCGGCUCCGCACUAUCUAUAGGUUAUGAAAUCAAA

Source Source

Source organism organism	Spizellomyces punctatus
NCBI taxonomy ID ncbi_taxonomy_id	109760
Host organism host_organism	Saccharomyces cerevisiae

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	1

▶

Resolution resolution	3.22 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	345331

Spizellomyces punctatus Fanzor (SpuFz) State 5

1. Protein Identity and Related Structures Protein Identity & Related Structures

Maltose/maltodextrin-binding periplasmic protein,Spizellomyces punctatus Fanzor 1

State in the Current Structure

Other States of the Same Protein in the Database

Maltose/maltodextrin-binding periplasmic protein,Spizellomyces punctatus Fanzor 1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9cey__assembly_1__model_1

9cey__assembly_1__model_1 | I(q)

9cey__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

7. Citations (1)

Spizellomyces punctatus Fanzor (SpuFz) State 5

1. Protein Identity and Related Structures Protein Identity & Related Structures

Maltose/maltodextrin-binding periplasmic protein,Spizellomyces punctatus Fanzor 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Maltose/maltodextrin-binding periplasmic protein,Spizellomyces punctatus Fanzor 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9cey__assembly_1__model_1

9cey__assembly_1__model_1 | I(q)

9cey__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

7. Citations (1)