SAXSdb — 9f6j

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase epsilon catalytic subunit A

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain A； UniProt 1–1200	Not recorded	DNA nascent strand × 1 DNA template strand × 1 SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.90 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9F6J	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
5VBN Crystal Structure of human DNA polymerase epsilon B-subunit in complex with C-terminal domain of catalytic subunit Deposited 2017-03-29	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain B 2142–2286（145 aa） Fragment：UNP residues 2142-2286	Not recorded	SO4 SULFATE ION × 1 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；295 K；50 mM sodium citrate, pH5.6, 0.70 M ammonium sulfate and 2 mM TCEP	Resolution 2.35 Å R-free 0.264
5VBN Crystal Structure of human DNA polymerase epsilon B-subunit in complex with C-terminal domain of catalytic subunit Deposited 2017-03-29	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain F 2142–2286（145 aa） Fragment：UNP residues 2142-2286	Not recorded	SO4 SULFATE ION × 1 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；295 K；50 mM sodium citrate, pH5.6, 0.70 M ammonium sulfate and 2 mM TCEP	Resolution 2.35 Å R-free 0.264
7PFO Core human replisome Deposited 2021-08-11	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 19 PDB declaration: 21-meric	Chain B 1–2286（2286 aa）	Not recorded	ZN ZINC ION × 5 MG MAGNESIUM ION × 3 ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 3 SO4 SULFATE ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
7PLO H. sapiens replisome-CUL2/LRR1 complex Deposited 2021-09-01	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 24 PDB declaration: 26-meric	Chain B 1–2286（2286 aa）	Not recorded	ZN ZINC ION × 8 MG MAGNESIUM ION × 3 ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 3 SO4 SULFATE ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
9B8S Human polymerase epsilon bound to PCNA and DNA in the nucleotide exchange state Deposited 2024-03-31	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–2286（2286 aa）	Mutation：D275A, E277A	SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 5.01 Å
9F6D Human DNA polymerase epsilon bound to DNA and PCNA (open conformation) Deposited 2024-05-01	Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–1200（1200 aa）	Mutation：D275A E277A	SF4 IRON/SULFUR CLUSTER × 1 DDS 2',3'-dideoxyadenosine triphosphate × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.60 Å
9F6E Human DNA polymerase epsilon bound to DNA and PCNA (ajar conformation) Deposited 2024-05-01	Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–1200（1200 aa）	Mutation：D275A E277A	SF4 IRON/SULFUR CLUSTER × 1 DDS 2',3'-dideoxyadenosine triphosphate × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.74 Å
9F6F Human DNA polymerase epsilon bound to DNA and PCNA (closed conformation) Deposited 2024-05-01	Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–1200（1200 aa）	Mutation：D275A E277A	SF4 IRON/SULFUR CLUSTER × 1 DDS 2',3'-dideoxyadenosine triphosphate × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.75 Å
9F6I Human DNA Polymerase epsilon bound to T-C mismatched DNA (Post-Insertion state) Deposited 2024-05-01	Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–1200（1200 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1 DDS 2',3'-dideoxyadenosine triphosphate × 1 CA CALCIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
9F6K Human DNA Polymerase epsilon bound to T-C mismatched DNA (Frayed Substrate state) Deposited 2024-05-01	Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–1200（1200 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.20 Å
9F6L Human DNA Polymerase epsilon bound to T-C mismatched DNA (Mismatch Excision state) Deposited 2024-05-01	Different ligand/ion	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–1200（1200 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1 CA CALCIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
9NE6 Human polymerase epsilon bound to PCNA and DNA with an in-situ-generated mismatch in the mismatch-editing state Deposited 2025-02-19	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–1200（1200 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.11 Å
9NE7 Human polymerase epsilon bound to PCNA and DNA with an in-situ-generated mismatch in the Pol-backtracking state Deposited 2025-02-19	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–1200（1200 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.53 Å
9NE8 Human polymerase epsilon bound to PCNA and DNA with an in-situ-generated mismatch in the mismatch-locking state Deposited 2025-02-19	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–1200（1200 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.60 Å
9NE9 Human polymerase epsilon bound to PCNA and DNA with a pre-existing mismatch in the blocked conformation I Deposited 2025-02-19	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 27–1198（1172 aa）	Not recorded	MG MAGNESIUM ION × 2 SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.88 Å
9NEA Human polymerase epsilon bound to PCNA and DNA with a pre-existing mismatch in the blocked conformation II Deposited 2025-02-19	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–2286（2286 aa）	Not recorded	MG MAGNESIUM ION × 1 SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.81 Å
9SRI Human DNA polymerase epsilon bound to DNA blunt end Deposited 2025-09-24	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 1–1200（1200 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å

16 other PDB entries and 17 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DPOE1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–1200； UniProt 1–1200

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9f6j
Deposition date deposition_date	2024-05-01
Structure title title	Human DNA Polymerase epsilon bound to T-C mismatched DNA (Polymerase Arrest state)
Keywords keywords	DNA, polymerase, epsilon, PCNA, leading strand, human, replication, replisome, proofreading; REPLICATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	35.81 Å
Radius of gyration Rg (electron density) rg_electron	35.07 Å
Forward intensity I(0) i0	321957000.00
Molecular weight molecular_weight	139300.0 kDa
Excluded volume excluded_volume	172140 Å³
Envelope volume envelope_volume	248780 Å³
Hydration-shell volume shell_volume	57440 Å³
Envelope diameter envelope_diameter	109.6 Å
Shell Rg shell_rg	43.10 Å
Envelope Rg envelope_rg	34.24 Å
Shape Rg shape_rg	35.07 Å
Total Rg total_rg	35.64 Å
Total atoms total_atoms	9751
Residues n_residues	1150
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	107.5 Å
Rg (real space) rg_real	35.55 Å
Rg uncertainty (real space) rg_real_error	0.58 Å
I(0) (real space) i0_real	3.2200e+08
I(0) uncertainty (real space) i0_real_error	5.1450e+06
Rg (reciprocal space) rg_reciprocal	35.71 Å
I(0) (reciprocal space) i0_reciprocal	322000000.0000
Solution quality estimate total_estimate	0.6981
Solution quality rating solution_quality	REASONABLE a REASONABLE solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	46.4 Å
Skewness Skewness skewness	0.038
Kurtosis Kurtosis kurtosis	-0.579
Angular range angular_range	— – 0.2200 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	40230000.0000
Real-space data points n_real_points	45
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.950; Stabil: 1.000; Sysdev: 0.101; Positv: 1.000; Valcen: 0.971; Smooth: 0.947

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	DNA polymerase epsilon catalytic subunit A
Molecular weight formula_weight	138137.6 kDa
EC 编号 ec_number	2.7.7.7,3.1.11.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	9751

MSLRSGGRRRADPGADGEASRDDGATSSVSALKRLERSQWTDKMDLRFGFERLKEPGEKTGWLINMHPTEILDEDKRLGSAVDYYFIQDDGSRFKVALPYKPYFYIATRKGCEREVSSFLSKKFQGKIAKVETVPKEDLDLPNHLVGLKRNYIRLSFHTVEDLVKVRKEISPAVKKNREQDHASDAYTALLSSVLQRGGVITDEEETSKKIADQLDNIVDMREYDVPYHIRLSIDLKIHVAHWYNVRYRGNAFPVEITRRDDLVERPDPVVLAFAIATTKLPLKFPDAETDQIMMISYMIDGQGYLITNREIVSEDIEDFEFTPKPEYEGPFCVFNEPDEAHLIQRWFEHVQETKPTIMVTYNGDFFDWPFVEARAAVHGLSMQQEIGFQKDSQGEYKAPQCIHMDCLRWVKRDSYLPVGSHNLKAAAKAKLGYDPVELDPEDMCRMATEQPQTLATYSVSDAVATYYLYMKYVHPFIFALCTIIPMEPDEVLRKGSGTLCEALLMVQAFHANIIFPNKQEQEFNKLTDDGHVLDSETYVGGHVEALESGVFRSDIPCRFRMNPAAFDFLLQRVEKTLRHALEEEEKVPVEQVTNFEEVCDEIKSKLASLKDVPSRIECPLIYHLDVGAMYPNIILTNRLQPSAMVDEATCAACDFNKPGANCQRKMAWQWRGEFMPASRSEYHRIQHQLESEKFPPLFPEGPARAFHELSREEQAKYEKRRLADYCRKAYKKIHITKVEERLTTICQRENSFYVDTVRAFRDRRYEFKGLHKVWKKKLSAAVEVGDAAEVKRCKNMEVLYDSLQLAHKCILNSFYGYVMRKGARWYSMEMAGIVCFTGANIITQARELIEQIGRPLELDTDGIWCVLPNSFPENFVFKTTNVKKPKVTISYPGAMLNIMVKEGFTNDQYQELAEPSSLTYVTRSENSIFFEVDGPYLAMILPASKEEGKKLKKRYAVFNEDGSLAELKGFEVKRRGELQLIKIFQSSVFEAFLKGSTLEEVYGSVAKVADYWLDVLYSKAANMPDSELFELISENRSMSRKLEDYGEQKSTSISTAKRLAEFLGDQMVKDAGLSCRYIISRKPEGSPVTERAIPLAIFQAEPTVRKHFLRKWLKSSSLQDFDIRAILDWDYYIERLGSAIQKIITIPAALQQVKNPVPRVKHPDWLHKKLLEKNDVYKQKKISELFTLEGRRQVTMAEA

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Trichoplusia ni

Entity 2 Entity 2 polymer

Description description	DNA nascent strand
Molecular weight formula_weight	9489.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	P

TTTTTTTTATCTGAAGTTCGAATCCTGGATC

Entity 3 Entity 3 polymer

Description description	DNA template strand
Molecular weight formula_weight	9458.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T

TTTTTTTTATCCAGGATTCGAACTTCAGATC

Entity 4 Entity 4 non-polymer

Description description	IRON/SULFUR CLUSTER
Molecular weight formula_weight	351.6 kDa
Source method src_method	syn
Copy count entity_count	1

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	3.90 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	44918

fit	/app/data/saxs_computation/f6/9f6j/9f6j.fit
pddf	/app/data/pr_computation/f6/9f6j/9f6j.pr.out
profile	/app/data/saxs_computation/f6/9f6j/9f6j.dat

Human DNA Polymerase epsilon bound to T-C mismatched DNA (Polymerase Arrest state)

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase epsilon catalytic subunit A

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)