SAXSdb — 9gc3

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Transcription factor tau 138 kDa subunit

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	Transcription factor tau 91 kDa subunit × 1 （Q06339） Transcription factor tau 60 kDa subunit × 1 （Q12308） DNA (40-MER) × 1 DNA (40-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TFC3_YEAST
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–1160； UniProt 1–1160

Transcription factor tau 91 kDa subunit

Saccharomyces cerevisiae

UniProt Q06339

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	Transcription factor tau 138 kDa subunit × 1 （P34111） Transcription factor tau 60 kDa subunit × 1 （Q12308） DNA (40-MER) × 1 DNA (40-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TFC6_YEAST
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 14–685； UniProt 1–672

Transcription factor tau 60 kDa subunit

Saccharomyces cerevisiae

UniProt Q12308

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	Transcription factor tau 138 kDa subunit × 1 （P34111） Transcription factor tau 91 kDa subunit × 1 （Q06339） DNA (40-MER) × 1 DNA (40-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TFC8_YEAST
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 1–588； UniProt 1–588

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9gc3
Deposition date deposition_date	2024-08-01
Structure title title	yeast TFIIIC TauB subcomplex bound to a tRNA gene
Keywords keywords	Base-specific contacts, B-box, tRNA gene, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9gc3__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9gc3__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9gc3__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	42.60 Å
Rg (electron density)	41.92 Å
Total Rg	42.30 Å
Atom count	15046
Residues	1753
Excluded volume	264210 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9gc3__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Transcription factor tau 138 kDa subunit
Molecular weight formula_weight	136602.5 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	15046

MVLTIYPDELVQIVSDKIASNKGKITLNQLWDISGKYFDLSDKKVKQFVLSCVILKKDIEVYCDGAITTKNVTDIIGDANHSYSVGITEDSLWTLLTGYTKKESTIGNSAFELLLEVAKSGEKGINTMDLAQVTGQDPRSVTGRIKKINHLLTSSQLIYKGHVVKQLKLKKFSHDGVDSNPYINIRDHLATIVEVVKRSKNGIRQIIDLKRELKFDKEKRLSKAFIAAIAWLDEKEYLKKVLVVSPKNPAIKIRCVKYVKDIPDSKGSPSFEYDSNSADEDSVSDSKAAFEDEDLVEGLDNFNATDLLQNQGLVMEEKEDAVKNEVLLNRFYPLQNQTYDIADKSGLKGISTMDVVNRITGKEFQRAFTKSSEYYLESVDKQKENTGGYRLFRIYDFEGKKKFFRLFTAQNFQKLTNAEDEISVPKGFDELGKSRTDLKTLNEDNFVALNNTVRFTTDSDGQDIFFWHGELKIPPNSKKTPNKNKRKRQVKNSTNASVAGNISNPKRIKLEQHVSTAQEPKSAEDSPSSNGGTVVKGKVVNFGGFSARSLRSLQRQRAILKVMNTIGGVAYLREQFYESVSKYMGSTTTLDKKTVRGDVDLMVESEKLGARTEPVSGRKIIFLPTVGEDAIQRYILKEKDSKKATFTDVIHDTEIYFFDQTEKNRFHRGKKSVERIRKFQNRQKNAKIKASDDAISKKSTSVNVSDGKIKRRDKKVSAGRTTVVVENTKEDKTVYHAGTKDGVQALIRAVVVTKSIKNEIMWDKITKLFPNNSLDNLKKKWTARRVRMGHSGWRAYVDKWKKMLVLAIKSEKISLRDVEELDLIKLLDIWTSFDEKEIKRPLFLYKNYEENRKKFTLVRDDTLTHSGNDLAMSSMIQREISSLKKTYTRKISASTKDLSKSQSDDYIRTVIRSILIESPSTTRNEIEALKNVGNESIDNVIMDMAKEKQIYLHGSKLECTDTLPDILENRGNYKDFGVAFQYRCKVNELLEAGNAIVINQEPSDISSWVLIDLISGELLNMDVIPMVRNVRPLTYTSRRFEIRTLTPPLIIYANSQTKLNTARKSAVKVPLGKPFSRLWVNGSGSIRPNIWKQVVTMVVNEIIFHPGITLSRLQSRCREVLSLHEISEICKWLLERQVLITTDFDGYWVNHNWYSIYESTENLYFQSMSASAWSHPQFEKGGGSGGGSGGSAWSHPQFEKS

Source Source

Source organism organism	Saccharomyces cerevisiae
Common name common_name	;brewer's yeast ;
NCBI taxonomy ID ncbi_taxonomy_id	4932
Host organism host_organism	Spodoptera frugiperda

Entity 2 Entity 2 polymer

Description description	Transcription factor tau 91 kDa subunit
Molecular weight formula_weight	76484.1 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

HHHHHHENLYFQGMAVIPAKKRGRPRKSVVAEVPYDSLASPVSENSGSKRPRRNASKKAVANFAQLVHAGRDDVINTTQVNNVDDTDDDDFVLNDEGDGEESDNVEIEFENELESTKNEVADLNSSGSGASVRPSGRRNTVQKLRLKKNSTKNMKSSSPGSSLGQKGRPIRLLKDLSSARDKIERIYGLNKEKLLLLAKVKEGFETSVFDFPFKNIQPDSPYFVCLDPPCKKESAYNKVIGDKNRTVYHEINKTEFENMIKLRTKRLKLLIGEVDAEVSTGDKIEFPVLANGKRRGFIYNVGGLVTDIAWLNIEENTDIGKDIQYLAVAVSQYMDEPLNEHLEMFDKEKHSSCIQIFKMNTSTLHCVKVQTIVHSFGEVWDLKWHEGCHAPHLVGCLSFVSQEGTINFLEIIDNATDVHVFKMCEKPSLTLSLADSLITTFDFLSPTTVVCGFKNGFVAEFDLTDPEVPSFYDQVHDSYILSVSTAYSDFEDTVVSTVAVDGYFYIFNPKDIATTKTTVSRFRGSNLVPVVYCPQIYSYIYSDGASSLRAVPSRAAFAVHPLVSRETTITAIGVSRLHPMVLAGSADGSLIITNAARRLLHGIKNSSATQKSLRLWKWDYSIKDDKYRIDSSYEVYPLTVNDVSKAKIDAHGINITCTKWNETSAGGKCYAFSNSAGLLTLEYLS

Source Source

Source organism organism	Saccharomyces cerevisiae
Common name common_name	;brewer's yeast ;
NCBI taxonomy ID ncbi_taxonomy_id	4932
Host organism host_organism	Spodoptera frugiperda

Entity 3 Entity 3 polymer

Description description	Transcription factor tau 60 kDa subunit
Molecular weight formula_weight	67755.2 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MKLLKDLLVDRKEFEDWKNNLTWARDGTLYLTTFPDISIGQPKYAKDINCNSKNLFHVKEFPLEFENKLDFELAQQNGLLNSQPVCYPRVCKPSPIDDWMAVLSNNGNVSVFKDNKMLTNLDSKGNLSSRTYHCFEWNPIESSIVVGNEDGELQFFSIRKNSENTPEFYFESSIRLSDAGSKDWVTHIVWYEDVLVAALSNNSVFSMTVSASSHQPVSRMIQNASRRKITDLKIVDYKVVLTCPGYVHKIDLKNYSISSLKTGSLENFHIIPLNHEKESTILLMSNKTSYKVLLEDELHVTADNIIAPYLEKKFKKWSTIWNEFNNYETTLVIHGISLSPDGYSIAIVYDMERVAFKYKIASEQSFNIMFAPLYHTWTISERAVGLAWYQTYQIYNQSLPKLPENFSMNKKLLNGNYPISLDFQSYLNALMKSEEMRIIMFLNMTIDKPSILSFLEALYEYAINKKSELTNSFDLACVLSIAAILKREAPIYNGTLLMKNSFLEETFNLESFTADPETVTSTTNNTWKRCGVTLLPILTTHVKICPVSKQRVIDIKRDDLNDYGWFTRGLLERFNEISVYCGTTLEVM

Source Source

Source organism organism	Saccharomyces cerevisiae
Common name common_name	;brewer's yeast ;
NCBI taxonomy ID ncbi_taxonomy_id	4932
Host organism host_organism	Spodoptera frugiperda

Entity 4 Entity 4 polymer

Description description	DNA (40-MER)
Molecular weight formula_weight	12358.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

GCCGATGAAACCCTGGTTCGATTCTAGGAGATGGCATTTT

Source Source

Source organism organism	Saccharomyces cerevisiae
NCBI taxonomy ID ncbi_taxonomy_id	4932
Host organism host_organism	Spodoptera frugiperda

Entity 5 Entity 5 polymer

Description description	DNA (40-MER)
Molecular weight formula_weight	12265.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

AAAATGCCATCTCCTAGAATCGAACCAGGGTTTCATCGGC

Source Source

Source organism organism	Saccharomyces cerevisiae
NCBI taxonomy ID ncbi_taxonomy_id	4932
Host organism host_organism	Spodoptera frugiperda

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.460 Å
Low-resolution limit resolution_low	2.460 Å
R factor r_factor	0.3223
R_work r_work	0.3223
R_free r_free	—

Resolution resolution	2.46 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	570437

yeast TFIIIC TauB subcomplex bound to a tRNA gene

1. Protein Identity and Related Structures Protein Identity & Related Structures

Transcription factor tau 138 kDa subunit

State in the Current Structure

Other States of the Same Protein in the Database

Transcription factor tau 91 kDa subunit

State in the Current Structure

Other States of the Same Protein in the Database

Transcription factor tau 60 kDa subunit

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9gc3__assembly_1__model_1

9gc3__assembly_1__model_1 | I(q)

9gc3__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

7. Citations (1)

yeast TFIIIC TauB subcomplex bound to a tRNA gene

1. Protein Identity and Related Structures Protein Identity & Related Structures

Transcription factor tau 138 kDa subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Transcription factor tau 91 kDa subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Transcription factor tau 60 kDa subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9gc3__assembly_1__model_1

9gc3__assembly_1__model_1 | I(q)

9gc3__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

7. Citations (1)