SAXSdb — 9jhb

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated protein, CT1133 family

Nitratidesulfovibrio vulgaris str. Hildenborough

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 17 RNA 1	RacrIC1 (124-MER) × 1 CRISPR-associated protein, TM1801 family × 9 （Q72WF7）	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q72WF8_NITV2
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–123； UniProt 490–612 Author chain E； PDBConstruct 1–123； UniProt 490–612 Author chain F； PDBConstruct 1–123； UniProt 490–612 Author chain G； PDBConstruct 1–123； UniProt 490–612 Author chain H； PDBConstruct 1–123； UniProt 490–612 Author chain I； PDBConstruct 1–123； UniProt 490–612 Author chain J； PDBConstruct 1–123； UniProt 490–612 Author chain R； PDBConstruct 1–123； UniProt 490–612

CRISPR-associated protein, TM1801 family

Nitratidesulfovibrio vulgaris str. Hildenborough

UniProt Q72WF7

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 17 RNA 1	RacrIC1 (124-MER) × 1 CRISPR-associated protein, CT1133 family × 8 （Q72WF8）	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q72WF7_NITV2
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 1–289； UniProt 2–290 Author chain D； PDBConstruct 1–289； UniProt 2–290 Author chain K； PDBConstruct 1–289； UniProt 2–290 Author chain L； PDBConstruct 1–289； UniProt 2–290 Author chain M； PDBConstruct 1–289； UniProt 2–290 Author chain N； PDBConstruct 1–289； UniProt 2–290 Author chain O； PDBConstruct 1–289； UniProt 2–290 Author chain P； PDBConstruct 1–289； UniProt 2–290 Author chain Q； PDBConstruct 1–289； UniProt 2–290

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9jhb
Deposition date deposition_date	2024-09-09
Structure title title	Cryo-EM structure of RacrIC1-Cascade IC1-complex II
Keywords keywords	complex, anti-CRISPR, Racr, cryo-EM, RNA BINDING PROTEIN/RNA, RNA BINDING PROTEIN-RNA complex; RNA BINDING PROTEIN/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9jhb__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9jhb__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9jhb__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	61.02 Å
Rg (electron density)	61.64 Å
Total Rg	61.64 Å
Atom count	28538
Residues	3540
Excluded volume	502530 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9jhb__assembly_1__model_1`	octadecameric （18）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	RacrIC1 (124-MER)
Molecular weight formula_weight	39847.7 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	A
Atom count atom_count	28538

UGGAUCGAAACACGACCUCGAGUCUGGUAAAGAAACCGCUGCUGCGAAAUUUGAACGCCAGCACAUGGACUCGUCUACUAGCGCAGCUUAAUUAACCUAGGCUGCUGCCACCGCUGAGCAAUAA

Source Source

Source organism organism	Bifidobacterium pseudocatenulatum
NCBI taxonomy ID ncbi_taxonomy_id	28026
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	CRISPR-associated protein, CT1133 family
Molecular weight formula_weight	13918.9 kDa
Source method src_method	man
Copy count entity_count	8

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,E,F,G,H,I,J,R

SLDPARTDRPYLLGRLFAVLEKAQEDAVPGANATIKDRYLASASANPGQVFHMLLKNASNHTAKLRKDPERKGSAIHYEIMMQEIIDNISDFPVTMSSDEQGLFMIGYYHQRKALFTKKNKEN

Source Source

Source organism organism	Nitratidesulfovibrio vulgaris str. Hildenborough
NCBI taxonomy ID ncbi_taxonomy_id	882
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	CRISPR-associated protein, TM1801 family
Molecular weight formula_weight	32227.7 kDa
Source method src_method	man
Copy count entity_count	9

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,D,K,L,M,N,O,P,Q

TAIANRYEFVLLFDVENGNPNGDPDAGNMPRIDPETGHGLVTDVCLKRKIRNHVALTKEGAERFNIYIQEKAILNETHERAYTACDLKPEPKKLPKKVEDAKRVTDWMCTNFYDIRTFGAVMTTEVNCGQVRGPVQMAFARSVEPVVPQEVSITRMAVTTKAEAEKQQGDNRTMGRKHIVPYGLYVAHGFISAPLAEKTGFSDEDLTLFWDALVNMFEHDRSAARGLMSSRKLIVFKHQNRLGNAPAHKLFDLVKVSRAEGSSGPARSFADYAVTVGQAPEGVEVKEML

Source Source

Source organism organism	Nitratidesulfovibrio vulgaris str. Hildenborough
NCBI taxonomy ID ncbi_taxonomy_id	882
Host organism host_organism	Escherichia coli

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.39 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	31837

Cryo-EM structure of RacrIC1-Cascade IC1-complex II

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated protein, CT1133 family

State in the Current Structure

Other States of the Same Protein in the Database

CRISPR-associated protein, TM1801 family

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9jhb__assembly_1__model_1

9jhb__assembly_1__model_1 | I(q)

9jhb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

7. Citations (1)

Cryo-EM structure of RacrIC1-Cascade IC1-complex II

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated protein, CT1133 family

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

CRISPR-associated protein, TM1801 family

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9jhb__assembly_1__model_1

9jhb__assembly_1__model_1 | I(q)

9jhb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

7. Citations (1)