SAXSdb — 9vzx

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

HNH nuclease domain-containing protein

Salicola phage CGphi29

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Homooligomer	Protein 2 DNA 2 RNA 1	RNA (36-MER) × 1 DNA (38-MER) × 1 DNA (38-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	M4R212_9CAUD
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–309； UniProt 1–309 Author chain B； PDBConstruct 1–309； UniProt 1–309

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9vzx
Deposition date deposition_date	2025-07-23
Structure title title	Cryo-EM structure of TasH-tigRNA-gap dsDNA complex
Keywords keywords	protein complex, ANTIVIRAL PROTEIN; ANTIVIRAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9vzx__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9vzx__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9vzx__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	28.26 Å
Rg (electron density)	28.63 Å
Total Rg	28.97 Å
Atom count	5222
Residues	549
Excluded volume	87794 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9vzx__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	HNH nuclease domain-containing protein
Molecular weight formula_weight	40031.2 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	5222

MNKQVLKEQASHCEITGAPLAGLPELVDVDRITERFQGGTYTPDNTRVLTPRAHMERHGILRERDQWLEELKAMMDDRAQTMKVVMKMNNQLLAYQRQTDHARQSTEQFLQDTLDASNKRLAQIDREVTKHIKHAKDPLAQAAMGVPGVGPITVAGLQTYVDLEKAKSASALWAYIGIDKPSHDRYTKGEAGGGNKTLRTMVWNMANSMIKNRKCPYRTVYEQTKERLAVSEKVTKSRNTQGQLIECAWKDTKPSHRHGAALRAVMKHFLADYWFVGRELAGLDTRPLYVQEKLGHTGIVQPQERGWEWGGSWSHPQFEKGGGSGGGSGGSAWSHPQFEKNLYFQSGSHHHHHH

Source Source

Source organism organism	Salicola phage CGphi29
NCBI taxonomy ID ncbi_taxonomy_id	754067
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RNA (36-MER)
Molecular weight formula_weight	11948.2 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C

AGUCAUUCCGUUAAAGACAACCACGGAGACGAAGCGA

Source Source

Source organism organism	Salicola phage CGphi29
NCBI taxonomy ID ncbi_taxonomy_id	754067
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA (38-MER)
Molecular weight formula_weight	11778.6 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

AAATTGATGACGGAGACGATTAACGGAATCGAAACCAC

Source Source

Source organism organism	Salicola phage CGphi29
NCBI taxonomy ID ncbi_taxonomy_id	754067
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	DNA (38-MER)
Molecular weight formula_weight	11608.4 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

GTGGTTTCGATTCCGTTAATCGTCTCCGTCATCAATTT

Source Source

Source organism organism	Salicola phage CGphi29
NCBI taxonomy ID ncbi_taxonomy_id	754067
Host organism host_organism	Escherichia coli

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.78 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	65896

Cryo-EM structure of TasH-tigRNA-gap dsDNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

HNH nuclease domain-containing protein

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9vzx__assembly_1__model_1

9vzx__assembly_1__model_1 | I(q)

9vzx__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

7. Citations (1)

Cryo-EM structure of TasH-tigRNA-gap dsDNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

HNH nuclease domain-containing protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9vzx__assembly_1__model_1

9vzx__assembly_1__model_1 | I(q)

9vzx__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

7. Citations (1)