SAXSdb — 9xzr

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

tRNA (guanine(9)-N1)-methyltransferase

Saccharomyces cerevisiae BMN1-35

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	Transfer RNA (Gly) × 1 5'-{[(3S)-3-amino-3-carboxypropyl](ethyl)amino}-5'-deoxyadenosine × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TRM10_YEAST
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–293； UniProt 1–293

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9xzr
Deposition date deposition_date	2025-08-27
Structure title title	Trm10-tRNA complex (open conformation)
Keywords keywords	SPOUT methyltransferase, tRNA, methylation, RNA BINDING PROTEIN, RNA BINDING PROTEIN-RNA complex; RNA BINDING PROTEIN/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9xzr__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9xzr__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9xzr__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	24.49 Å
Rg (electron density)	23.44 Å
Total Rg	24.10 Å
Atom count	2981
Residues	247
Excluded volume	47564 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9xzr__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	Transfer RNA (Gly)
Molecular weight formula_weight	22809.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	A
Atom count atom_count	2981

GCGCAAGUGGUUUAGUGGUAAAAUCCAACGUUGCCAUCGUUGGGCCCCCGGUUCGAUUCCGGGCUUGCGCA

Entity 2 Entity 2 polymer

Description description	tRNA (guanine(9)-N1)-methyltransferase
Molecular weight formula_weight	34583.6 kDa
EC 编号 ec_number	2.1.1.221
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MSNDEINQNEEKVKRTPPLPPVPEGMSKKQWKKMCKRQRWEENKAKYNAERRVKKKRLRHERSAKIQEYIDRGEEVPQELIREPRINVNQTDSGIEIILDCSFDELMNDKEIVSLSNQVTRAYSANRRANHFAEIKVAPFDKRLKQRFETTLKNTNYENWNHFKFLPDDKIMFGDEHISKDKIVYLTADTEEKLEKLEPGMRYIVGGIVDKNRYKELCLKKAQKMGIPTRRLPIDEYINLEGRRVLTTTHVVQLMLKYFDDHNWKNAFESVLPPRKLDAEAKSASSSPAPKDT

Source Source

Source organism organism	Saccharomyces cerevisiae BMN1-35
NCBI taxonomy ID ncbi_taxonomy_id	1216345
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 non-polymer

Description description	5'-{[(3S)-3-amino-3-carboxypropyl](ethyl)amino}-5'-deoxyadenosine
Molecular weight formula_weight	395.4 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.37 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	1440392

Trm10-tRNA complex (open conformation)

1. Protein Identity and Related Structures Protein Identity & Related Structures

tRNA (guanine(9)-N1)-methyltransferase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9xzr__assembly_1__model_1

9xzr__assembly_1__model_1 | I(q)

9xzr__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

7. Citations (1)

Trm10-tRNA complex (open conformation)

1. Protein Identity and Related Structures Protein Identity & Related Structures

tRNA (guanine(9)-N1)-methyltransferase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9xzr__assembly_1__model_1

9xzr__assembly_1__model_1 | I(q)

9xzr__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

7. Citations (1)