SAXSdb — 9xzs

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

tRNA (guanine(9)-N1)-methyltransferase

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Homooligomer Protein × 2 RNA 1 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain B； UniProt 1–293 Chain C； UniProt 1–293	Not recorded	Transfer RNA (Gly) × 1 AN6 5'-{[(3S)-3-amino-3-carboxypropyl](ethyl)amino}-5'-deoxyadenosine × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.89 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9XZS	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
4JWJ Crystal structure of scTrm10(84)-SAH complex Deposited 2013-03-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 84–276（193 aa） Fragment：UNP RESIDUES 84-276	Not recorded	SO4 SULFATE ION × 3 SAH S-ADENOSYL-L-HOMOCYSTEINE × 1 TRS 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；287 K；1.5M Lithium sulfate monohydrate, 0.1M BIS-TRIS propane, pH 7.0, vapor diffusion, hanging drop, temperature 287K	Resolution 1.76 Å R-free 0.251
4JWJ Crystal structure of scTrm10(84)-SAH complex Deposited 2013-03-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 84–276（193 aa） Fragment：UNP RESIDUES 84-276	Not recorded	SO4 SULFATE ION × 1 SAH S-ADENOSYL-L-HOMOCYSTEINE × 1 TRS 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；287 K；1.5M Lithium sulfate monohydrate, 0.1M BIS-TRIS propane, pH 7.0, vapor diffusion, hanging drop, temperature 287K	Resolution 1.76 Å R-free 0.251
9XZQ Trm10-tRNA complex (closed conformation) Deposited 2025-08-27	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain B 1–293（293 aa）	Not recorded	AN6 5'-{[(3S)-3-amino-3-carboxypropyl](ethyl)amino}-5'-deoxyadenosine × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.63 Å
9XZR Trm10-tRNA complex (open conformation) Deposited 2025-08-27	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain B 1–293（293 aa）	Not recorded	AN6 5'-{[(3S)-3-amino-3-carboxypropyl](ethyl)amino}-5'-deoxyadenosine × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.37 Å

3 other PDB entries and 4 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	TRM10_YEAST
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–293； UniProt 1–293 Author chain C； PDBConstruct 1–293； UniProt 1–293

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9xzs
Deposition date deposition_date	2025-08-27
Structure title title	Trm10-tRNA complex (Two Trm10 monomers bound to one tRNA)
Keywords keywords	SPOUT methyltransferase, tRNA, methylation, RNA BINDING PROTEIN, RNA BINDING PROTEIN-RNA complex; RNA BINDING PROTEIN/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	30.60 Å
Radius of gyration Rg (electron density) rg_electron	31.11 Å
Forward intensity I(0) i0	107642000.00
Molecular weight molecular_weight	65569.0 kDa
Excluded volume excluded_volume	74861 Å³
Envelope volume envelope_volume	107650 Å³
Hydration-shell volume shell_volume	30403 Å³
Envelope diameter envelope_diameter	110.8 Å
Shell Rg shell_rg	36.31 Å
Envelope Rg envelope_rg	30.63 Å
Shape Rg shape_rg	31.10 Å
Total Rg total_rg	31.52 Å
Total atoms total_atoms	4513
Residues n_residues	430
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	104.9 Å
Rg (real space) rg_real	30.71 Å
Rg uncertainty (real space) rg_real_error	0.90 Å
I(0) (real space) i0_real	1.0760e+08
I(0) uncertainty (real space) i0_real_error	1.6810e+06
Rg (reciprocal space) rg_reciprocal	30.67 Å
I(0) (reciprocal space) i0_reciprocal	107600000.0000
Solution quality estimate total_estimate	0.8777
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	32.3 Å
Skewness Skewness skewness	0.412
Kurtosis Kurtosis kurtosis	-0.301
Angular range angular_range	— – 0.2600 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	5896000.0000
Real-space data points n_real_points	53
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.852; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.903; Smooth: 0.945

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	Transfer RNA (Gly)
Molecular weight formula_weight	22832.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	A
Atom count atom_count	4513

GCGCAAGAGGUUUAGUGGUAAAAUCCAACGUUGCCAUCGUUGGGCCCCCGGUUCGAUUCCGGGCUUGCGCA

Entity 2 Entity 2 polymer

Description description	tRNA (guanine(9)-N1)-methyltransferase
Molecular weight formula_weight	34583.6 kDa
EC 编号 ec_number	2.1.1.221
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,C

MSNDEINQNEEKVKRTPPLPPVPEGMSKKQWKKMCKRQRWEENKAKYNAERRVKKKRLRHERSAKIQEYIDRGEEVPQELIREPRINVNQTDSGIEIILDCSFDELMNDKEIVSLSNQVTRAYSANRRANHFAEIKVAPFDKRLKQRFETTLKNTNYENWNHFKFLPDDKIMFGDEHISKDKIVYLTADTEEKLEKLEPGMRYIVGGIVDKNRYKELCLKKAQKMGIPTRRLPIDEYINLEGRRVLTTTHVVQLMLKYFDDHNWKNAFESVLPPRKLDAEAKSASSSPAPKDT

来源 Source

来源生物 organism	Saccharomyces cerevisiae
通用名 common_name	;brewer's yeast ;
NCBI Class编号 ncbi_taxonomy_id	4932
宿主生物 host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 non-polymer

Description description	5'-{[(3S)-3-amino-3-carboxypropyl](ethyl)amino}-5'-deoxyadenosine
Molecular weight formula_weight	395.4 kDa
Source method src_method	syn
Copy count entity_count	1

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.89 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	156897

fit	/app/data/saxs_computation/xz/9xzs/9xzs.fit
pddf	/app/data/pr_computation/xz/9xzs/9xzs.pr.out
profile	/app/data/saxs_computation/xz/9xzs/9xzs.dat

Trm10-tRNA complex (Two Trm10 monomers bound to one tRNA)

1. Protein Identity and Related Structures Protein Identity & Related Structures

tRNA (guanine(9)-N1)-methyltransferase

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)