← Back to search

9z2t

CryoEM structure of human NSUN2 with tRNA Lys(CTT) and SFG (No D-arm conformation)

Method: ELECTRON MICROSCOPY D_max: 91.2 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9z2t
deposition_date	2025-11-05
title	CryoEM structure of human NSUN2 with tRNA Lys(CTT) and SFG (No D-arm conformation)
keywords	Transferase, Methyltransferase, tRNA, Complex; TRANSFERASE
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	28.96 Å
rg_electron	28.00 Å
i0	156922000.00
molecular_weight	86767.0 kDa
excluded_volume	103320 Å³
envelope_volume	137460 Å³
shell_volume	39932 Å³
envelope_diameter	96.0 Å
shell_rg	36.28 Å
envelope_rg	28.03 Å
shape_rg	28.01 Å
total_rg	28.70 Å
total_atoms	6021
n_residues	651
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	91.2 Å
rg_real	28.86 Å
rg_real_error	0.51 Å
i0_real	1.5690e+08
i0_real_error	2.2670e+06
rg_reciprocal	28.90 Å
i0_reciprocal	156900000.0000
total_estimate	0.8973
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	34.8 Å
skewness	0.254
kurtosis	-0.344
angular_range	— – 0.2750 Å⁻¹
current_alpha	0.0000
highest_alpha	19260000.0000
n_real_points	56
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.902; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.997; Smooth: 0.958

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (3)

Entity 1 polymer

description	RNA cytosine C(5)-methyltransferase NSUN2
formula_weight	88414.7 kDa
ec_number	2.1.1.-,2.1.1.203
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	6021

MHHHHHHENLYFQGSGGRRSRGRRLQQQQRPEDAEDGAEGGGKRGEAGWEGGYPEIVKENKLFEHYYQELKIVPEGEWGQFMDALREPLPATLRITGYKSHAKEILHCLKNKYFKELEDLEVDGQKVEVPQPLSWYPEELAWHTNLSRKILRKSPHLEKFHQFLVSETESGNISRQEAVSMIPPLLLNVRPHHKILDMCAAPGSKTTQLIEMLHADMNVPFPEGFVIANDVDNKRCYLLVHQAKRLSSPCIMVVNHDASSIPRLQIDVDGRKEILFYDRILCDVPCSGDGTMRKNIDVWKKWTTLNSLQLHGLQLRIATRGAEQLAEGGRMVYSTCSLNPIEDEAVIASLLEKSEGALELADVSNELPGLKWMPGITQWKVMTKDGQWFTDWDAVPHSRHTQIRPTMFPPKDPEKLQAMHLERCLRILPHHQNTGGFFVAVLVKKSSMPWNKRQPKLQGKSAETRESTQLSPADLTEGKPTDPSKLESPSFTGTGDTEIAHATEDLENNGSKKDGVCGPPPSKKMKLFGFKEDPFVFIPEDDPLFPPIEKFYALDPSFPRMNLLTRTTEGKKRQLYMVSKELRNVLLNNSEKMKVINTGIKVWCRNNSGEEFDCAFRLAQEGIYTLYPFINSRIITVSMEDVKILLTQENPFFRKLSSETYSQAKDLAKGSIVLKYEPDSANPDALQCPIVLCGWRGKASIRTFVPKNERLHYLRMMGLEVLGEKKKEGVILTNESAASTGQPDNDVTEGQRAGEPNSPDAEEANSPDVTAGCDPAGVHPPR

Source

organism	Homo sapiens
common_name	human
ncbi_taxonomy_id	9606
host_organism	Escherichia coli

Entity 2 polymer

description	tRNA Lys(CTT)
formula_weight	24492.5 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	B

GCCCGGCUAGCUCAGUCGGUAGAGCAUGGGACUCUUAAUCCCAGGGUCGUGGGUUCGAGCCCCACGUUGGGCGCCA

Entity 3 non-polymer

description	SINEFUNGIN
formula_weight	381.4 kDa
src_method	syn
entity_count	1

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	3.700 Å
resolution_low	— Å
r_factor	—
r_work	—
r_free	—

resolution	3.70 Å
resolution_method	—
num_particles	31000

fit	/app/data/saxs_computation/z2/9z2t/9z2t.fit
pddf	/app/data/pr_computation/z2/9z2t/9z2t.pr.out
profile	/app/data/saxs_computation/z2/9z2t/9z2t.dat

CryoEM structure of human NSUN2 with tRNA Lys(CTT) and SFG (No D-arm conformation)

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

EM 3D

5. Entities & Polymer Info (3)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 non-polymer

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)