SAXSdb — 9z3d

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA cytosine C(5)-methyltransferase NSUN2

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 2–767	Not recorded	RNA (26-MER) × 1 S-ADENOSYL-L-HOMOCYSTEINE × 1	ELECTRON MICROSCOPY mmCIF provides none of the parsed experimental conditions	Resolution 2.96 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9Z3D	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
9Z2N CryoEM structure of human NSUN2(C271A) with SAH cross-linked to tRNA Lys(CTT) (D-arm conformation) Deposited 2025-11-05	Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 2–767（766 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 2.57 Å
9Z2O CryoEM structure of human NSUN2(C271A) with SAH cross-linked to tRNA Lys(CTT) (No D-arm conformation) Deposited 2025-11-05	Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 2–767（766 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 2.66 Å
9Z2P CryoEM structure of human NSUN2 with tRNA Lys(CTT) (Conformation 1) Deposited 2025-11-05	Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 2–767（766 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 2.91 Å
9Z2Q CryoEM structure of human NSUN2 with tRNA Lys(CTT) (Conformation 2) Deposited 2025-11-05	Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 2–767（766 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 2.88 Å
9Z2R CryoEM structure of human NSUN2 with tRNA Lys(CTT) and SFG (D-arm conformation) Deposited 2025-11-05	Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 2–767（766 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.71 Å
9Z2T CryoEM structure of human NSUN2 with tRNA Lys(CTT) and SFG (No D-arm conformation) Deposited 2025-11-05	Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 2–767（766 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.70 Å
9Z2U CryoEM structure of human NSUN2(C271A) with SAH cross-linked to tRNA Lys(TTT) (D-arm conformation) Deposited 2025-11-05	Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 2–767（766 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.00 Å
9Z2W CryoEM structure of human NSUN2(C271A) with SAH cross-linked to tRNA Lys(TTT) (No D-arm conformation) Deposited 2025-11-05	Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 2–767（766 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.10 Å

8 other PDB entries and 8 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	NSUN2_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 17–782； UniProt 2–767

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9z3d
Deposition date deposition_date	2025-11-06
Structure title title	CryoEM structure of human NSUN2(C271A) with SAH cross-linked to a pre-tRNA Leu(CAA) intron
Keywords keywords	Transferase, Methyltransferase, tRNA, Complex; TRANSFERASE
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	27.33 Å
Radius of gyration Rg (electron density) rg_electron	26.79 Å
Forward intensity I(0) i0	191124000.00
Molecular weight molecular_weight	70715.0 kDa
Excluded volume excluded_volume	66949 Å³
Envelope volume envelope_volume	116380 Å³
Hydration-shell volume shell_volume	35598 Å³
Envelope diameter envelope_diameter	95.8 Å
Shell Rg shell_rg	34.76 Å
Envelope Rg envelope_rg	27.07 Å
Shape Rg shape_rg	26.83 Å
Total Rg total_rg	27.30 Å
Total atoms total_atoms	5301
Residues n_residues	613
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	91.6 Å
Rg (real space) rg_real	27.27 Å
Rg uncertainty (real space) rg_real_error	0.63 Å
I(0) (real space) i0_real	1.9110e+08
I(0) uncertainty (real space) i0_real_error	2.8820e+06
Rg (reciprocal space) rg_reciprocal	27.29 Å
I(0) (reciprocal space) i0_reciprocal	191100000.0000
Solution quality estimate total_estimate	0.8751
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	33.2 Å
Skewness Skewness skewness	0.350
Kurtosis Kurtosis kurtosis	-0.202
Angular range angular_range	— – 0.2900 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	29940000.0000
Real-space data points n_real_points	59
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.812; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 1.000; Smooth: 0.937

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	RNA cytosine C(5)-methyltransferase NSUN2
Molecular weight formula_weight	88382.6 kDa
EC 编号 ec_number	2.1.1.-,2.1.1.203
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	5301

MHHHHHHENLYFQGSGGRRSRGRRLQQQQRPEDAEDGAEGGGKRGEAGWEGGYPEIVKENKLFEHYYQELKIVPEGEWGQFMDALREPLPATLRITGYKSHAKEILHCLKNKYFKELEDLEVDGQKVEVPQPLSWYPEELAWHTNLSRKILRKSPHLEKFHQFLVSETESGNISRQEAVSMIPPLLLNVRPHHKILDMCAAPGSKTTQLIEMLHADMNVPFPEGFVIANDVDNKRCYLLVHQAKRLSSPCIMVVNHDASSIPRLQIDVDGRKEILFYDRILCDVPASGDGTMRKNIDVWKKWTTLNSLQLHGLQLRIATRGAEQLAEGGRMVYSTCSLNPIEDEAVIASLLEKSEGALELADVSNELPGLKWMPGITQWKVMTKDGQWFTDWDAVPHSRHTQIRPTMFPPKDPEKLQAMHLERCLRILPHHQNTGGFFVAVLVKKSSMPWNKRQPKLQGKSAETRESTQLSPADLTEGKPTDPSKLESPSFTGTGDTEIAHATEDLENNGSKKDGVCGPPPSKKMKLFGFKEDPFVFIPEDDPLFPPIEKFYALDPSFPRMNLLTRTTEGKKRQLYMVSKELRNVLLNNSEKMKVINTGIKVWCRNNSGEEFDCAFRLAQEGIYTLYPFINSRIITVSMEDVKILLTQENPFFRKLSSETYSQAKDLAKGSIVLKYEPDSANPDALQCPIVLCGWRGKASIRTFVPKNERLHYLRMMGLEVLGEKKKEGVILTNESAASTGQPDNDVTEGQRAGEPNSPDAEEANSPDVTAGCDPAGVHPPR

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RNA (26-MER)
Molecular weight formula_weight	9879.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

CUCAAGGUAAGCACCUUGCCUGCGGGCUUUC

来源 Source

来源生物 organism	Homo sapiens
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	S-ADENOSYL-L-HOMOCYSTEINE
Molecular weight formula_weight	384.4 kDa
Source method src_method	syn
Copy count entity_count	1

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.960 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	2.96 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	65000

fit	/app/data/saxs_computation/z3/9z3d/9z3d.fit
pddf	/app/data/pr_computation/z3/9z3d/9z3d.pr.out
profile	/app/data/saxs_computation/z3/9z3d/9z3d.dat

CryoEM structure of human NSUN2(C271A) with SAH cross-linked to a pre-tRNA Leu(CAA) intron

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA cytosine C(5)-methyltransferase NSUN2

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)