PDB 编号 标题 正式曲线 结构单元 实验方法
1r6n HPV11 E2 TAD complex crystal structure 1 1 X-RAY DIFFRACTION
1r6o ATP-dependent Clp protease ATP-binding subunit clpA/ATP-dependent Clp protease adaptor protein clpS 3 3 X-RAY DIFFRACTION
1r6p NMR structure of the N-terminal domain of trout cardiac troponin C at 7 C 40 40 SOLUTION NMR
1r6q ClpNS with fragments 3 3 X-RAY DIFFRACTION
1r6r Solution Structure of Dengue Virus Capsid Protein Reveals a New Fold 21 21 SOLUTION NMR
1r6t crystal structure of human tryptophanyl-tRNA synthetase 1 1 X-RAY DIFFRACTION
1r6u Crystal structure of an active fragment of human tryptophanyl-tRNA synthetase with cytokine activity 1 1 X-RAY DIFFRACTION
1r6v Crystal structure of fervidolysin from Fervidobacterium pennivorans, a keratinolytic enzyme related to subtilisin 1 1 X-RAY DIFFRACTION
1r6w Crystal structure of the K133R mutant of o-Succinylbenzoate synthase (OSBS) from Escherichia coli. Complex with SHCHC 1 1 X-RAY DIFFRACTION
1r6x The Crystal Structure of a Truncated Form of Yeast ATP Sulfurylase, Lacking the C-Terminal APS Kinase-like Domain, in complex with Sulfate 1 1 X-RAY DIFFRACTION
1r6y Crystal structure of YgiN from Escherichia coli 1 1 X-RAY DIFFRACTION
1r6z The Crystal Structure of the Argonaute2 PAZ domain (as a MBP fusion) 4 4 X-RAY DIFFRACTION
1r70 Model of human IgA2 determined by solution scattering, curve fitting and homology modelling 1 1 SOLUTION SCATTERING
1r71 Crystal Structure of the DNA binding domain of KorB in complex with the operator DNA 2 2 X-RAY DIFFRACTION
1r73 Solution Structure of TM1492, the L29 ribosomal protein from Thermotoga maritima 20 20 SOLUTION NMR
1r74 Crystal Structure of Human Glycine N-Methyltransferase 1 1 X-RAY DIFFRACTION
1r75 Leishmania major hypothetical protein 1 1 X-RAY DIFFRACTION
1r76 Structure of a pectate lyase from Azospirillum irakense 1 1 X-RAY DIFFRACTION
1r77 Crystal structure of the cell wall targeting domain of peptidylglycan hydrolase ALE-1 2 2 X-RAY DIFFRACTION
1r78 CDK2 complex with a 4-alkynyl oxindole inhibitor 1 1 X-RAY DIFFRACTION
1r79 Solution Structure of The C1 Domain of The Human Diacylglycerol Kinase Delta 20 20 SOLUTION NMR
1r7a Sucrose Phosphorylase from Bifidobacterium adolescentis 1 1 X-RAY DIFFRACTION
1r7c NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Minimized average structure, Sample in 50% tfe) 1 1 SOLUTION NMR
1r7d NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Ensemble of 51 structures, sample in 50% tfe) 51 51 SOLUTION NMR
1r7e NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Minimized average structure. Sample in 100mM SDS). 1 1 SOLUTION NMR
1r7f NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Ensemble of 43 structures. Sample in 100mM SDS) 43 43 SOLUTION NMR
1r7g NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Minimized average structure, Sample in 100mM DPC) 1 1 SOLUTION NMR
1r7h NrdH-redoxin of Corynebacterium ammoniagenes forms a domain-swapped dimer 1 1 X-RAY DIFFRACTION
1r7i HMG-CoA Reductase from P. mevalonii, native structure at 2.2 angstroms resolution. 3 3 X-RAY DIFFRACTION
1r7j Crystal structure of the DNA-binding protein Sso10a from Sulfolobus solfataricus 1 1 X-RAY DIFFRACTION
1r7l 2.0 A Crystal Structure of a Phage Protein from Bacillus cereus ATCC 14579 1 1 X-RAY DIFFRACTION
1r7m The homing endonuclease I-SceI bound to its DNA recognition region 2 2 X-RAY DIFFRACTION
1r7o Crystal Structure of apo-mannanase 26A from Psudomonas cellulosa 1 1 X-RAY DIFFRACTION
1r7r The crystal structure of murine p97/VCP at 3.6A 1 1 X-RAY DIFFRACTION
1r7s PUTIDAREDOXIN (Fe2S2 ferredoxin), C73G mutant 3 3 X-RAY DIFFRACTION
1r7t Glycosyltransferase A in complex with 3-deoxy-acceptor analog inhibitor 2 2 X-RAY DIFFRACTION
1r7u Glycosyltransferase B in complex with 3-deoxy-acceptor analog inhibitor 2 2 X-RAY DIFFRACTION
1r7v Glycosyltransferase A in complex with 3-amino-acceptor analog inhibitor 2 2 X-RAY DIFFRACTION
1r7w NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE 20 20 SOLUTION NMR
1r7x Glycosyltransferase B in complex with 3-amino-acceptor analog inhibitor 2 2 X-RAY DIFFRACTION
1r7y Glycosyltransferase A in complex with 3-amino-acceptor analog inhibitor and uridine diphosphate 2 2 X-RAY DIFFRACTION
1r7z NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE 20 20 SOLUTION NMR
1r80 Glycosyltransferase B in complex with 3-amino-acceptor analog inhibitor and uridine diphosphate 2 2 X-RAY DIFFRACTION
1r81 Glycosyltransferase A in complex with 3-amino-acceptor analog inhibitor and uridine diphosphate-N-acetyl-galactose 2 2 X-RAY DIFFRACTION
1r82 Glycosyltransferase B in complex with 3-amino-acceptor analog inhibitor, and uridine diphosphate-galactose 2 2 X-RAY DIFFRACTION
1r84 NMR structure of the 13-cis-15-syn retinal in dark_adapted bacteriorhodopsin 12 12 SOLUTION NMR
1r85 Crystal structure of the extracellular xylanase from Geobacillus stearothermophilus T-6 (XT6): The WT enzyme (monoclinic form) at 1.45A resolution 1 1 X-RAY DIFFRACTION
1r86 Crystal structure of the extracellular xylanase from Geobacillus stearothermophilus T-6 (XT6, monoclinic form): The E159A/E265A mutant at 1.8A resolution 1 1 X-RAY DIFFRACTION
1r87 Crystal structure of the extracellular xylanase from Geobacillus stearothermophilus T-6 (XT6, monoclinic form): The complex of the WT enzyme with xylopentaose at 1.67A resolution 1 1 X-RAY DIFFRACTION
1r88 The crystal structure of Mycobacterium tuberculosis MPT51 (FbpC1) 2 2 X-RAY DIFFRACTION