PDB 编号 标题 Rg (Å) Dmax (Å) 实验方法 质量评级
1r6n HPV11 E2 TAD complex crystal structure 21.4 75.5 X-RAY DIFFRACTION GOOD
1r6o ATP-dependent Clp protease ATP-binding subunit clpA/ATP-dependent Clp protease adaptor protein clpS 31.6 107.0 X-RAY DIFFRACTION GOOD
1r6p NMR structure of the N-terminal domain of trout cardiac troponin C at 7 C 13.2 42.0 SOLUTION NMR GOOD
1r6q ClpNS with fragments 31.7 106.2 X-RAY DIFFRACTION GOOD
1r6r Solution Structure of Dengue Virus Capsid Protein Reveals a New Fold 17.6 56.2 SOLUTION NMR GOOD
1r6t crystal structure of human tryptophanyl-tRNA synthetase 33.7 120.5 X-RAY DIFFRACTION GOOD
1r6u Crystal structure of an active fragment of human tryptophanyl-tRNA synthetase with cytokine activity 33.0 120.0 X-RAY DIFFRACTION GOOD
1r6v Crystal structure of fervidolysin from Fervidobacterium pennivorans, a keratinolytic enzyme related to subtilisin 29.1 101.2 X-RAY DIFFRACTION GOOD
1r6w Crystal structure of the K133R mutant of o-Succinylbenzoate synthase (OSBS) from Escherichia coli. Complex with SHCHC 21.3 74.0 X-RAY DIFFRACTION GOOD
1r6x ;The Crystal Structure of a Truncated Form of Yeast ATP Sulfurylase, Lacking the C-Terminal APS Kinase-like Domain, in complex with Sulfate ; 22.9 80.5 X-RAY DIFFRACTION GOOD
1r6y Crystal structure of YgiN from Escherichia coli 15.4 50.4 X-RAY DIFFRACTION GOOD
1r6z The Crystal Structure of the Argonaute2 PAZ domain (as a MBP fusion) 42.5 133.9 X-RAY DIFFRACTION GOOD
1r70 Model of human IgA2 determined by solution scattering, curve fitting and homology modelling 50.7 143.6 SOLUTION SCATTERING REASONABLE
1r71 Crystal Structure of the DNA binding domain of KorB in complex with the operator DNA 28.2 90.0 X-RAY DIFFRACTION GOOD
1r73 Solution Structure of TM1492, the L29 ribosomal protein from Thermotoga maritima 13.7 49.9 SOLUTION NMR REASONABLE
1r74 Crystal Structure of Human Glycine N-Methyltransferase 27.1 89.1 X-RAY DIFFRACTION GOOD
1r75 Leishmania major hypothetical protein 15.8 57.4 X-RAY DIFFRACTION GOOD
1r76 Structure of a pectate lyase from Azospirillum irakense 22.4 74.5 X-RAY DIFFRACTION GOOD
1r77 Crystal structure of the cell wall targeting domain of peptidylglycan hydrolase ALE-1 19.3 62.2 X-RAY DIFFRACTION GOOD
1r78 CDK2 complex with a 4-alkynyl oxindole inhibitor 20.7 68.6 X-RAY DIFFRACTION REASONABLE
1r79 Solution Structure of The C1 Domain of The Human Diacylglycerol Kinase Delta 21.0 99.2 SOLUTION NMR REASONABLE
1r7a Sucrose Phosphorylase from Bifidobacterium adolescentis 33.0 111.0 X-RAY DIFFRACTION REASONABLE
1r7c ;NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Minimized average structure, Sample in 50% tfe) ; 14.5 59.4 SOLUTION NMR REASONABLE
1r7d ;NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Ensemble of 51 structures, sample in 50% tfe) ; 13.6 57.2 SOLUTION NMR REASONABLE
1r7e ;NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Minimized average structure. Sample in 100mM SDS). ; 14.7 55.8 SOLUTION NMR REASONABLE
1r7f ;NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Ensemble of 43 structures. Sample in 100mM SDS) ; 13.6 55.5 SOLUTION NMR REASONABLE
1r7g ;NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Minimized average structure, Sample in 100mM DPC) ; 15.0 56.6 SOLUTION NMR REASONABLE
1r7h NrdH-redoxin of Corynebacterium ammoniagenes forms a domain-swapped dimer 18.2 61.6 X-RAY DIFFRACTION GOOD
1r7i HMG-CoA Reductase from P. mevalonii, native structure at 2.2 angstroms resolution. 26.9 79.3 X-RAY DIFFRACTION EXCELLENT
1r7j Crystal structure of the DNA-binding protein Sso10a from Sulfolobus solfataricus 16.9 64.9 X-RAY DIFFRACTION REASONABLE
1r7l 2.0 A Crystal Structure of a Phage Protein from Bacillus cereus ATCC 14579 20.9 78.3 X-RAY DIFFRACTION REASONABLE
1r7m The homing endonuclease I-SceI bound to its DNA recognition region 31.7 113.2 X-RAY DIFFRACTION GOOD
1r7o Crystal Structure of apo-mannanase 26A from Psudomonas cellulosa 20.6 61.2 X-RAY DIFFRACTION EXCELLENT
1r7r The crystal structure of murine p97/VCP at 3.6A 30.4 94.3 X-RAY DIFFRACTION EXCELLENT
1r7s PUTIDAREDOXIN (Fe2S2 ferredoxin), C73G mutant 23.4 78.5 X-RAY DIFFRACTION GOOD
1r7t Glycosyltransferase A in complex with 3-deoxy-acceptor analog inhibitor 19.8 64.9 X-RAY DIFFRACTION GOOD
1r7u Glycosyltransferase B in complex with 3-deoxy-acceptor analog inhibitor 19.8 64.9 X-RAY DIFFRACTION GOOD
1r7v Glycosyltransferase A in complex with 3-amino-acceptor analog inhibitor 19.7 63.8 X-RAY DIFFRACTION REASONABLE
1r7w NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE 17.4 57.6 SOLUTION NMR GOOD
1r7x Glycosyltransferase B in complex with 3-amino-acceptor analog inhibitor 19.6 65.6 X-RAY DIFFRACTION GOOD
1r7y Glycosyltransferase A in complex with 3-amino-acceptor analog inhibitor and uridine diphosphate 19.6 65.1 X-RAY DIFFRACTION GOOD
1r7z NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE 15.9 48.0 SOLUTION NMR GOOD
1r80 Glycosyltransferase B in complex with 3-amino-acceptor analog inhibitor and uridine diphosphate 19.7 65.4 X-RAY DIFFRACTION GOOD
1r81 Glycosyltransferase A in complex with 3-amino-acceptor analog inhibitor and uridine diphosphate-N-acetyl-galactose 19.8 67.4 X-RAY DIFFRACTION GOOD
1r82 Glycosyltransferase B in complex with 3-amino-acceptor analog inhibitor, and uridine diphosphate-galactose 19.8 69.5 X-RAY DIFFRACTION GOOD
1r84 NMR structure of the 13-cis-15-syn retinal in dark_adapted bacteriorhodopsin 18.3 60.0 SOLUTION NMR GOOD
1r85 ;Crystal structure of the extracellular xylanase from Geobacillus stearothermophilus T-6 (XT6): The WT enzyme (monoclinic form) at 1.45A resolution ; 22.4 72.2 X-RAY DIFFRACTION REASONABLE
1r86 ;Crystal structure of the extracellular xylanase from Geobacillus stearothermophilus T-6 (XT6, monoclinic form): The E159A/E265A mutant at 1.8A resolution ; 22.3 72.4 X-RAY DIFFRACTION GOOD
1r87 ;Crystal structure of the extracellular xylanase from Geobacillus stearothermophilus T-6 (XT6, monoclinic form): The complex of the WT enzyme with xylopentaose at 1.67A resolution ; 22.0 71.1 X-RAY DIFFRACTION GOOD
1r88 The crystal structure of Mycobacterium tuberculosis MPT51 (FbpC1) 29.3 95.0 X-RAY DIFFRACTION GOOD